BCO-DMO ERDDAP
Accessing BCO-DMO data 		log in    
Brought to you by BCO-DMO    
 
 
Row Type Variable Name Attribute Name Data Type Value
attribute NC_GLOBAL access_formats String .htmlTable,.csv,.json,.mat,.nc,.tsv,.esriCsv,.geoJson
attribute NC_GLOBAL acquisition_description String Sampling and Analytical Methodology:  \n Genomic DNA was extracted from Baltic Sea Basin sediments using\nFastDNA\\u00ae Spin Kit for Soil  \n (MP Biomedicals). 16S rRNA gene copy numbers of targets were quantified with\nqPCR using the  \n primers in the table in datasheet. Results of qPCR were rejected if the R2\nof the standard curve was  \n below 0.95, or if the melt curve showed evidence of primer dimers. SYBR\ngreen chemistry was used  \n for all reactions, and Invitrogen mastermix was used for DNA copy number\nmeasurement on a  \n BioRad iQ5 (Applied Biosystems, Foster City, California). Serial dilutions\nof full-length 16S rRNA  \n gene PCR products from plasmids containing amplified partial 16S genes were\nused as standards.\n \n\\u00a0\n \nPrimers Used:\n \n    \n     Primer name     Sequence (5' - 3')           Target          Reference Bac340f         TCCTACGGGAGGCAGCAGT          Bacteria        Nadkarni et al., 2002 Bac 515r        CGTATTACCGCGGCTGCTGGCAC      Bacteria        Nadkarni et al., 2002 Arch915f        GTGCTCCCCCGCCAATTCCT         Archaea         Kubo et al., 2012 Arch1059r       GCCATGCACCWCCTCT             Archaea         Kubo et al., 2012 ANME1-628f      GCT TTC AGG GAA TAC TGC      ANME-1          Lloyd et al., 2011 ANME1-830r      TCG CAG TAA TGC CAA CAC      ANME-1          Lloyd et al., 2011 MCG528f         CGGTAATACCAGCTCTCCGAG                        Kubo et al., 2012 MCG732r         CGCGTTCTAGCCGACAGC                           Kubo et al., 2012 \n\\u00a0\n \nPrimers used from the following publications:  \n[Archaea of the Miscellaneous Crenarchaeotal Group are abundant, diverse and\nwidespread in marine\nsediments](\\\\\"http://dmoserv3.whoi.edu/data_docs/IODP_347/Archaea)\n \n[Determination of bacterial load by real-time PCR using a broad-range\n(universal) probe and primers\nset](\\\\\"http://dmoserv3.whoi.edu/data_docs/IODP_347/Determination)\n \n[Environmental evidence for net methane production and oxidation in putative\nANaerobic MEthanotrophic (ANME)\narchaea](\\\\\"http://dmoserv3.whoi.edu/data_docs/IODP_347/Environmental)
attribute NC_GLOBAL awards_0_award_nid String 639416
attribute NC_GLOBAL awards_0_award_number String OCE-1431598
attribute NC_GLOBAL awards_0_data_url String http://www.nsf.gov/awardsearch/showAward.do?AwardNumber=1431598 (external link)
attribute NC_GLOBAL awards_0_funder_name String NSF Division of Ocean Sciences
attribute NC_GLOBAL awards_0_funding_acronym String NSF OCE
attribute NC_GLOBAL awards_0_funding_source_nid String 355
attribute NC_GLOBAL awards_0_program_manager String Dr Thomas Janecek
attribute NC_GLOBAL awards_0_program_manager_nid String 511697
attribute NC_GLOBAL cdm_data_type String Other
attribute NC_GLOBAL comment String IODP-347 Quantitative PCR data from sediments \n  PIs: Lloyd, Steen \n  Version: 25 March 2016
attribute NC_GLOBAL Conventions String COARDS, CF-1.6, ACDD-1.3
attribute NC_GLOBAL creator_email String info at bco-dmo.org
attribute NC_GLOBAL creator_name String BCO-DMO
attribute NC_GLOBAL creator_type String institution
attribute NC_GLOBAL creator_url String https://www.bco-dmo.org/ (external link)
attribute NC_GLOBAL data_source String extract_data_as_tsv version 2.3  19 Dec 2019
attribute NC_GLOBAL date_created String 2016-03-25T14:34:56Z
attribute NC_GLOBAL date_modified String 2016-11-15T18:15:09Z
attribute NC_GLOBAL defaultDataQuery String &time<now
attribute NC_GLOBAL doi String 10.1575/1912/bco-dmo.664686
attribute NC_GLOBAL Easternmost_Easting double 18.254
attribute NC_GLOBAL geospatial_lat_max double 58.622167
attribute NC_GLOBAL geospatial_lat_min double 55.00483
attribute NC_GLOBAL geospatial_lat_units String degrees_north
attribute NC_GLOBAL geospatial_lon_max double 18.254
attribute NC_GLOBAL geospatial_lon_min double 10.107828
attribute NC_GLOBAL geospatial_lon_units String degrees_east
attribute NC_GLOBAL infoUrl String https://www.bco-dmo.org/dataset/641358 (external link)
attribute NC_GLOBAL institution String BCO-DMO
attribute NC_GLOBAL instruments_0_acronym String Thermal Cycler
attribute NC_GLOBAL instruments_0_dataset_instrument_description String Genomic DNA was extracted from Baltic Sea Basin sediments using FastDNA® Spin Kit for Soil\n(MP Biomedicals). 16S rRNA gene copy numbers of targets were quantified with qPCR using the\nprimers in the table in datasheet. Results of qPCR were rejected if the R2 of the standard curve was\nbelow 0.95, or if the melt curve showed evidence of primer dimers. SYBR green chemistry was used\nfor all reactions, and Invitrogen mastermix was used for DNA copy number measurement on a\nBioRad iQ5 (Applied Biosystems, Foster City, California). Serial dilutions of full-length 16S rRNA\ngene PCR products from plasmids containing amplified partial 16S genes were used as standards.\nBioRad iQ5
attribute NC_GLOBAL instruments_0_dataset_instrument_nid String 641476
attribute NC_GLOBAL instruments_0_description String General term for a laboratory apparatus commonly used for performing polymerase chain reaction (PCR). The device has a thermal block with holes where tubes with the PCR reaction mixtures can be inserted. The cycler then raises and lowers the temperature of the block in discrete, pre-programmed steps.\n\n(adapted from http://serc.carleton.edu/microbelife/research_methods/genomics/pcr.html)
attribute NC_GLOBAL instruments_0_instrument_name String PCR Thermal Cycler
attribute NC_GLOBAL instruments_0_instrument_nid String 471582
attribute NC_GLOBAL instruments_0_supplied_name String BioRad iQ5
attribute NC_GLOBAL instruments_1_acronym String Thermal Cycler
attribute NC_GLOBAL instruments_1_dataset_instrument_description String Genomic DNA was extracted from Baltic Sea Basin sediments using FastDNA® Spin Kit for Soil\n(MP Biomedicals). 16S rRNA gene copy numbers of targets were quantified with qPCR using the\nprimers in the table in datasheet. Results of qPCR were rejected if the R2 of the standard curve was\nbelow 0.95, or if the melt curve showed evidence of primer dimers. SYBR green chemistry was used\nfor all reactions, and Invitrogen mastermix was used for DNA copy number measurement on a\nBioRad iQ5 (Applied Biosystems, Foster City, California). Serial dilutions of full-length 16S rRNA\ngene PCR products from plasmids containing amplified partial 16S genes were used as standards.\nFastDNA® Spin Kit for Soil
attribute NC_GLOBAL instruments_1_dataset_instrument_nid String 641477
attribute NC_GLOBAL instruments_1_description String General term for a laboratory apparatus commonly used for performing polymerase chain reaction (PCR). The device has a thermal block with holes where tubes with the PCR reaction mixtures can be inserted. The cycler then raises and lowers the temperature of the block in discrete, pre-programmed steps.\n\n(adapted from http://serc.carleton.edu/microbelife/research_methods/genomics/pcr.html)
attribute NC_GLOBAL instruments_1_instrument_name String PCR Thermal Cycler
attribute NC_GLOBAL instruments_1_instrument_nid String 471582
attribute NC_GLOBAL instruments_1_supplied_name String FastDNA® Spin Kit for Soil
attribute NC_GLOBAL keywords String anme1, ANME1_replicate_1, ANME1_replicate_2, archaea, Archaea_replicate_1, Archaea_replicate_2, bacteria, Bacteria_replicate_1, Bacteria_replicate_2, bco, bco-dmo, biological, chemical, data, dataset, depth, dmo, erddap, identifier, latitude, longitude, management, mcg, MCG_replicate_1, MCG_replicate_2, oceanography, office, preliminary, replicate
attribute NC_GLOBAL license String https://www.bco-dmo.org/dataset/641358/license (external link)
attribute NC_GLOBAL metadata_source String https://www.bco-dmo.org/api/dataset/641358 (external link)
attribute NC_GLOBAL Northernmost_Northing double 58.622167
attribute NC_GLOBAL param_mapping String {'641358': {'Latitude': 'flag - latitude', 'Longitude': 'flag - longitude'}}
attribute NC_GLOBAL parameter_source String https://www.bco-dmo.org/mapserver/dataset/641358/parameters (external link)
attribute NC_GLOBAL people_0_affiliation String University of Tennessee Knoxville
attribute NC_GLOBAL people_0_affiliation_acronym String UTK
attribute NC_GLOBAL people_0_person_name String Dr Karen G. Lloyd
attribute NC_GLOBAL people_0_person_nid String 639420
attribute NC_GLOBAL people_0_role String Principal Investigator
attribute NC_GLOBAL people_0_role_type String originator
attribute NC_GLOBAL people_1_affiliation String University of Tennessee Knoxville
attribute NC_GLOBAL people_1_affiliation_acronym String UTK
attribute NC_GLOBAL people_1_person_name String Dr Andrew Steen
attribute NC_GLOBAL people_1_person_nid String 554160
attribute NC_GLOBAL people_1_role String Co-Principal Investigator
attribute NC_GLOBAL people_1_role_type String originator
attribute NC_GLOBAL people_2_affiliation String University of Tennessee Knoxville
attribute NC_GLOBAL people_2_affiliation_acronym String UTK
attribute NC_GLOBAL people_2_person_name String Dr Karen G. Lloyd
attribute NC_GLOBAL people_2_person_nid String 639420
attribute NC_GLOBAL people_2_role String Contact
attribute NC_GLOBAL people_2_role_type String related
attribute NC_GLOBAL people_3_affiliation String Woods Hole Oceanographic Institution
attribute NC_GLOBAL people_3_affiliation_acronym String WHOI BCO-DMO
attribute NC_GLOBAL people_3_person_name String Stephen R. Gegg
attribute NC_GLOBAL people_3_person_nid String 50910
attribute NC_GLOBAL people_3_role String BCO-DMO Data Manager
attribute NC_GLOBAL people_3_role_type String related
attribute NC_GLOBAL project String IODP-347 Microbial Quantification
attribute NC_GLOBAL projects_0_acronym String IODP-347 Microbial Quantification
attribute NC_GLOBAL projects_0_description String Marine sediments contain a microbial population large enough to rival that of Earth's oceans, but much about this vast community is unknown. Innovations in total cell counting methods have refined estimates of cell concentrations, but tell us nothing about specific taxa. Isotopic data provides evidence that a majority of subsurface microorganisms survive by breaking down organic matter, yet measurable links between specific microbial taxa and their organic matter substrates are untested. The proposed work overcomes these limitations, with a particular focus on the degradation of proteins and carbohydrates, which comprise the bulk of classifiable sedimentary organic matter. The project will link specific taxa to potential extracellular enzyme activity in the genomes of single microbial cells, apply newly-identified, optimal methods for counting viable cells belonging to specific taxa using catalyzed reporter deposition fluorescent in situ hybridization (CARD-FISH), and measure the potential activity of their enzymes in situ. The resulting data will provide key evidence about the strategies subsurface life uses to overcome extreme energy limitation and contribute to the long-term carbon cycle.\nThe Principal Investigators are employing novel,improved methods to quantify cells of specific taxa in the marine subsurface and to determine the biogeochemical functions of those uncultured taxa, including:\n1) Determine the pathway of organic carbon degradation in single cell genomes of uncultured, numerically dominant subsurface microorganisms.\n2) Quantify viable bacteria and archaea in the deep subsurface using an improvement on the existing technology of CARD-FISH.\n3 )Measure the potential activities (Vmax values) of enzymes in deep Baltic Sea sediments, and use the abundances of enzyme-producing microorganisms to calculate depth profiles of cell-specific Vmax values.\nThe project combines these methods in order to identify and quantify the cells capable of degrading organic matter in deep sediments of the Baltic Sea, obtained from Integrated Ocean Drilling Program (IODP) expedition 347. These results will greatly expand our knowledge of the function and activity of uncultured microorganisms in the deep subsurface.\nThis project is associated with C-DEBI account number 157595.
attribute NC_GLOBAL projects_0_end_date String 2016-08
attribute NC_GLOBAL projects_0_geolocation String Baltic Sea
attribute NC_GLOBAL projects_0_name String Quantifying the contribution of the deep biosphere in the marine sediment carbon cycle using deep-sea sediment cores from the Baltic Sea
attribute NC_GLOBAL projects_0_project_nid String 639417
attribute NC_GLOBAL projects_0_start_date String 2014-09
attribute NC_GLOBAL publisher_name String Biological and Chemical Oceanographic Data Management Office (BCO-DMO)
attribute NC_GLOBAL publisher_type String institution
attribute NC_GLOBAL sourceUrl String (local files)
attribute NC_GLOBAL Southernmost_Northing double 55.00483
attribute NC_GLOBAL standard_name_vocabulary String CF Standard Name Table v55
attribute NC_GLOBAL summary String Quantitative PCR data from sediment samples\n \nLocations:  \n Site 59C (Little Belt); Site 60B (Anholt Loch); 63E (Landsort Deep); 65C\n(Bornholm Basin).  \n Subsurface samples as deep as 85 meters below the Baltic Sea floor.
attribute NC_GLOBAL title String [qPCR] - Quantitative PCR data from sediment samples from MPSV GREATSHIP MANISHA IODP-347 cruise in the Baltic Sea in 2013 (IODP-347 Microbial Quantification project) (Quantifying the contribution of the deep biosphere in the marine sediment carbon cycle using deep-sea sediment cores from the Baltic Sea)
attribute NC_GLOBAL version String 1
attribute NC_GLOBAL Westernmost_Easting double 10.107828
attribute NC_GLOBAL xml_source String osprey2erddap.update_xml() v1.3
variable Identifier String
attribute Identifier bcodmo_name String sample
attribute Identifier description String Sample Identifier
attribute Identifier long_name String Identifier
attribute Identifier nerc_identifier String https://vocab.nerc.ac.uk/collection/P02/current/ACYC/ (external link)
attribute Identifier units String text
variable latitude double
attribute latitude _CoordinateAxisType String Lat
attribute latitude _FillValue double NaN
attribute latitude actual_range double 55.00483, 58.622167
attribute latitude axis String Y
attribute latitude bcodmo_name String latitude
attribute latitude colorBarMaximum double 90.0
attribute latitude colorBarMinimum double -90.0
attribute latitude description String Site Latitude (South is negative)
attribute latitude ioos_category String Location
attribute latitude long_name String Latitude
attribute latitude nerc_identifier String https://vocab.nerc.ac.uk/collection/P09/current/LATX/ (external link)
attribute latitude standard_name String latitude
attribute latitude units String degrees_north
variable longitude double
attribute longitude _CoordinateAxisType String Lon
attribute longitude _FillValue double NaN
attribute longitude actual_range double 10.107828, 18.254
attribute longitude axis String X
attribute longitude bcodmo_name String longitude
attribute longitude colorBarMaximum double 180.0
attribute longitude colorBarMinimum double -180.0
attribute longitude description String Site Longitude (West is negative)
attribute longitude ioos_category String Location
attribute longitude long_name String Longitude
attribute longitude nerc_identifier String https://vocab.nerc.ac.uk/collection/P09/current/LONX/ (external link)
attribute longitude standard_name String longitude
attribute longitude units String degrees_east
variable Depth float
attribute Depth _FillValue float NaN
attribute Depth actual_range float 1.1, 84.42
attribute Depth bcodmo_name String depth_core
attribute Depth colorBarMaximum double 8000.0
attribute Depth colorBarMinimum double -8000.0
attribute Depth colorBarPalette String TopographyDepth
attribute Depth description String Depth of sample in core
attribute Depth long_name String Depth
attribute Depth standard_name String depth
attribute Depth units String meters
variable Archaea_replicate_1 float
attribute Archaea_replicate_1 _FillValue float NaN
attribute Archaea_replicate_1 actual_range float 11500.0, 1.66E7
attribute Archaea_replicate_1 bcodmo_name String unknown
attribute Archaea_replicate_1 description String Archaea replicate 1 (Units are copies of target DNA per microliter of DNA)
attribute Archaea_replicate_1 long_name String Archaea Replicate 1
attribute Archaea_replicate_1 units String copies/uL
variable Archaea_replicate_2 float
attribute Archaea_replicate_2 _FillValue float NaN
attribute Archaea_replicate_2 actual_range float 12800.0, 2.28E7
attribute Archaea_replicate_2 bcodmo_name String unknown
attribute Archaea_replicate_2 description String Archaea replicate 2 (Units are copies of target DNA per microliter of DNA)
attribute Archaea_replicate_2 long_name String Archaea Replicate 2
attribute Archaea_replicate_2 units String copies/uL
variable Bacteria_replicate_1 float
attribute Bacteria_replicate_1 _FillValue float NaN
attribute Bacteria_replicate_1 actual_range float 1160000.0, 1.63E8
attribute Bacteria_replicate_1 bcodmo_name String unknown
attribute Bacteria_replicate_1 description String Bacteria replicate 1 (Units are copies of target DNA per microliter of DNA)
attribute Bacteria_replicate_1 long_name String Bacteria Replicate 1
attribute Bacteria_replicate_1 units String copies/uL
variable Bacteria_replicate_2 float
attribute Bacteria_replicate_2 _FillValue float NaN
attribute Bacteria_replicate_2 actual_range float 1180000.0, 1.46E8
attribute Bacteria_replicate_2 bcodmo_name String unknown
attribute Bacteria_replicate_2 description String Bacteria replicate 2 (Units are copies of target DNA per microliter of DNA)
attribute Bacteria_replicate_2 long_name String Bacteria Replicate 2
attribute Bacteria_replicate_2 units String copies/uL
variable ANME1_replicate_1 float
attribute ANME1_replicate_1 _FillValue float NaN
attribute ANME1_replicate_1 actual_range float 204000.0, 847000.0
attribute ANME1_replicate_1 bcodmo_name String unknown
attribute ANME1_replicate_1 description String ANME1 replicate 1 (Units are copies of target DNA per microliter of DNA)
attribute ANME1_replicate_1 long_name String ANME1 Replicate 1
attribute ANME1_replicate_1 units String copies/uL
variable ANME1_replicate_2 float
attribute ANME1_replicate_2 _FillValue float NaN
attribute ANME1_replicate_2 actual_range float 182000.0, 825000.0
attribute ANME1_replicate_2 bcodmo_name String unknown
attribute ANME1_replicate_2 description String ANME1 replicate 2 (Units are copies of target DNA per microliter of DNA)
attribute ANME1_replicate_2 long_name String ANME1 Replicate 2
attribute ANME1_replicate_2 units String copies/uL
variable MCG_replicate_1 float
attribute MCG_replicate_1 _FillValue float NaN
attribute MCG_replicate_1 actual_range float 6130.0, 2210000.0
attribute MCG_replicate_1 bcodmo_name String unknown
attribute MCG_replicate_1 description String MCG replicate 1 (Units are copies of target DNA per microliter of DNA)
attribute MCG_replicate_1 long_name String MCG Replicate 1
attribute MCG_replicate_1 units String copies/uL
variable MCG_replicate_2 float
attribute MCG_replicate_2 _FillValue float NaN
attribute MCG_replicate_2 actual_range float 2660.0, 1670000.0
attribute MCG_replicate_2 bcodmo_name String unknown
attribute MCG_replicate_2 description String MCG replicate 2 (Units are copies of target DNA per microliter of DNA)
attribute MCG_replicate_2 long_name String MCG Replicate 2
attribute MCG_replicate_2 units String copies/uL

 
ERDDAP, Version 2.22
Disclaimers | Privacy Policy | Contact