|
BCO-DMO ERDDAP
Accessing BCO-DMO data |
log in
Brought to you by BCO-DMO |
| Grid DAP Data | Sub- set | Table DAP Data | Make A Graph | W M S | Source Data Files | Acces- sible
| Title | Sum- mary | FGDC, ISO, Metadata | Back- ground Info | RSS | E | Institution | Dataset ID |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| data | graph | files | public | [qPCR] - Quantitative PCR data from sediment samples from MPSV GREATSHIP MANISHA IODP-347 cruise in the Baltic Sea in 2013 (IODP-347 Microbial Quantification project) (Quantifying the contribution of the deep biosphere in the marine sediment carbon cycle using deep-sea sediment cores from the Baltic Sea) |
| F I M | background
|
|
| BCO-DMO | bcodmo_dataset_641358 |
| Row Type | Variable Name | Attribute Name | Data Type | Value |
|---|---|---|---|---|
| attribute | NC_GLOBAL | access_formats | String | .htmlTable,.csv,.json,.mat,.nc,.tsv,.esriCsv,.geoJson |
| attribute | NC_GLOBAL | acquisition_description | String | Sampling and Analytical Methodology: Genomic DNA was extracted from Baltic Sea Basin sediments using FastDNA\u00ae Spin Kit for Soil (MP Biomedicals). 16S rRNA gene copy numbers of targets were quantified with qPCR using the primers in the table in datasheet. Results of qPCR were rejected if the R2 of the standard curve was below 0.95, or if the melt curve showed evidence of primer dimers. SYBR green chemistry was used for all reactions, and Invitrogen mastermix was used for DNA copy number measurement on a BioRad iQ5 (Applied Biosystems, Foster City, California). Serial dilutions of full-length 16S rRNA gene PCR products from plasmids containing amplified partial 16S genes were used as standards. \u00a0 Primers Used: Primer name Sequence (5' - 3') Target Reference Bac340f TCCTACGGGAGGCAGCAGT Bacteria Nadkarni et al., 2002 Bac 515r CGTATTACCGCGGCTGCTGGCAC Bacteria Nadkarni et al., 2002 Arch915f GTGCTCCCCCGCCAATTCCT Archaea Kubo et al., 2012 Arch1059r GCCATGCACCWCCTCT Archaea Kubo et al., 2012 ANME1-628f GCT TTC AGG GAA TAC TGC ANME-1 Lloyd et al., 2011 ANME1-830r TCG CAG TAA TGC CAA CAC ANME-1 Lloyd et al., 2011 MCG528f CGGTAATACCAGCTCTCCGAG Kubo et al., 2012 MCG732r CGCGTTCTAGCCGACAGC Kubo et al., 2012 \u00a0 Primers used from the following publications: [Archaea of the Miscellaneous Crenarchaeotal Group are abundant, diverse and widespread in marine sediments](\\"http://dmoserv3.whoi.edu/data_docs/IODP_347/Archaea) [Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set](\\"http://dmoserv3.whoi.edu/data_docs/IODP_347/Determination) [Environmental evidence for net methane production and oxidation in putative ANaerobic MEthanotrophic (ANME) archaea](\\"http://dmoserv3.whoi.edu/data_docs/IODP_347/Environmental) |
| attribute | NC_GLOBAL | awards_0_award_nid | String | 639416 |
| attribute | NC_GLOBAL | awards_0_award_number | String | OCE-1431598 |
| attribute | NC_GLOBAL | awards_0_data_url | String | http://www.nsf.gov/awardsearch/showAward.do?AwardNumber=1431598![]() |
| attribute | NC_GLOBAL | awards_0_funder_name | String | NSF Division of Ocean Sciences |
| attribute | NC_GLOBAL | awards_0_funding_acronym | String | NSF OCE |
| attribute | NC_GLOBAL | awards_0_funding_source_nid | String | 355 |
| attribute | NC_GLOBAL | awards_0_program_manager | String | Dr Thomas Janecek |
| attribute | NC_GLOBAL | awards_0_program_manager_nid | String | 511697 |
| attribute | NC_GLOBAL | cdm_data_type | String | Other |
| attribute | NC_GLOBAL | comment | String | IODP-347 Quantitative PCR data from sediments PIs: Lloyd, Steen Version: 25 March 2016 |
| attribute | NC_GLOBAL | Conventions | String | COARDS, CF-1.6, ACDD-1.3 |
| attribute | NC_GLOBAL | creator_email | String | info at bco-dmo.org |
| attribute | NC_GLOBAL | creator_name | String | BCO-DMO |
| attribute | NC_GLOBAL | creator_type | String | institution |
| attribute | NC_GLOBAL | creator_url | String | https://www.bco-dmo.org/![]() |
| attribute | NC_GLOBAL | data_source | String | extract_data_as_tsv version 2.3 19 Dec 2019 |
| attribute | NC_GLOBAL | date_created | String | 2016-03-25T14:34:56Z |
| attribute | NC_GLOBAL | date_modified | String | 2016-11-15T18:15:09Z |
| attribute | NC_GLOBAL | defaultDataQuery | String | &time<now |
| attribute | NC_GLOBAL | doi | String | 10.1575/1912/bco-dmo.664686 |
| attribute | NC_GLOBAL | Easternmost_Easting | double | 18.254 |
| attribute | NC_GLOBAL | geospatial_lat_max | double | 58.622167 |
| attribute | NC_GLOBAL | geospatial_lat_min | double | 55.00483 |
| attribute | NC_GLOBAL | geospatial_lat_units | String | degrees_north |
| attribute | NC_GLOBAL | geospatial_lon_max | double | 18.254 |
| attribute | NC_GLOBAL | geospatial_lon_min | double | 10.107828 |
| attribute | NC_GLOBAL | geospatial_lon_units | String | degrees_east |
| attribute | NC_GLOBAL | infoUrl | String | https://www.bco-dmo.org/dataset/641358![]() |
| attribute | NC_GLOBAL | institution | String | BCO-DMO |
| attribute | NC_GLOBAL | instruments_0_acronym | String | Thermal Cycler |
| attribute | NC_GLOBAL | instruments_0_dataset_instrument_description | String | Genomic DNA was extracted from Baltic Sea Basin sediments using FastDNA® Spin Kit for Soil (MP Biomedicals). 16S rRNA gene copy numbers of targets were quantified with qPCR using the primers in the table in datasheet. Results of qPCR were rejected if the R2 of the standard curve was below 0.95, or if the melt curve showed evidence of primer dimers. SYBR green chemistry was used for all reactions, and Invitrogen mastermix was used for DNA copy number measurement on a BioRad iQ5 (Applied Biosystems, Foster City, California). Serial dilutions of full-length 16S rRNA gene PCR products from plasmids containing amplified partial 16S genes were used as standards. BioRad iQ5 |
| attribute | NC_GLOBAL | instruments_0_dataset_instrument_nid | String | 641476 |
| attribute | NC_GLOBAL | instruments_0_description | String | General term for a laboratory apparatus commonly used for performing polymerase chain reaction (PCR). The device has a thermal block with holes where tubes with the PCR reaction mixtures can be inserted. The cycler then raises and lowers the temperature of the block in discrete, pre-programmed steps. (adapted from http://serc.carleton.edu/microbelife/research_methods/genomics/pcr.html) |
| attribute | NC_GLOBAL | instruments_0_instrument_name | String | PCR Thermal Cycler |
| attribute | NC_GLOBAL | instruments_0_instrument_nid | String | 471582 |
| attribute | NC_GLOBAL | instruments_0_supplied_name | String | BioRad iQ5 |
| attribute | NC_GLOBAL | instruments_1_acronym | String | Thermal Cycler |
| attribute | NC_GLOBAL | instruments_1_dataset_instrument_description | String | Genomic DNA was extracted from Baltic Sea Basin sediments using FastDNA® Spin Kit for Soil (MP Biomedicals). 16S rRNA gene copy numbers of targets were quantified with qPCR using the primers in the table in datasheet. Results of qPCR were rejected if the R2 of the standard curve was below 0.95, or if the melt curve showed evidence of primer dimers. SYBR green chemistry was used for all reactions, and Invitrogen mastermix was used for DNA copy number measurement on a BioRad iQ5 (Applied Biosystems, Foster City, California). Serial dilutions of full-length 16S rRNA gene PCR products from plasmids containing amplified partial 16S genes were used as standards. FastDNA® Spin Kit for Soil |
| attribute | NC_GLOBAL | instruments_1_dataset_instrument_nid | String | 641477 |
| attribute | NC_GLOBAL | instruments_1_description | String | General term for a laboratory apparatus commonly used for performing polymerase chain reaction (PCR). The device has a thermal block with holes where tubes with the PCR reaction mixtures can be inserted. The cycler then raises and lowers the temperature of the block in discrete, pre-programmed steps. (adapted from http://serc.carleton.edu/microbelife/research_methods/genomics/pcr.html) |
| attribute | NC_GLOBAL | instruments_1_instrument_name | String | PCR Thermal Cycler |
| attribute | NC_GLOBAL | instruments_1_instrument_nid | String | 471582 |
| attribute | NC_GLOBAL | instruments_1_supplied_name | String | FastDNA® Spin Kit for Soil |
| attribute | NC_GLOBAL | keywords | String | anme1, ANME1_replicate_1, ANME1_replicate_2, archaea, Archaea_replicate_1, Archaea_replicate_2, bacteria, Bacteria_replicate_1, Bacteria_replicate_2, bco, bco-dmo, biological, chemical, data, dataset, depth, dmo, erddap, identifier, latitude, longitude, management, mcg, MCG_replicate_1, MCG_replicate_2, oceanography, office, preliminary, replicate |
| attribute | NC_GLOBAL | license | String | https://www.bco-dmo.org/dataset/641358/license![]() |
| attribute | NC_GLOBAL | metadata_source | String | https://www.bco-dmo.org/api/dataset/641358![]() |
| attribute | NC_GLOBAL | Northernmost_Northing | double | 58.622167 |
| attribute | NC_GLOBAL | param_mapping | String | {'641358': {'Latitude': 'flag - latitude', 'Longitude': 'flag - longitude'}} |
| attribute | NC_GLOBAL | parameter_source | String | https://www.bco-dmo.org/mapserver/dataset/641358/parameters![]() |
| attribute | NC_GLOBAL | people_0_affiliation | String | University of Tennessee Knoxville |
| attribute | NC_GLOBAL | people_0_affiliation_acronym | String | UTK |
| attribute | NC_GLOBAL | people_0_person_name | String | Dr Karen G. Lloyd |
| attribute | NC_GLOBAL | people_0_person_nid | String | 639420 |
| attribute | NC_GLOBAL | people_0_role | String | Principal Investigator |
| attribute | NC_GLOBAL | people_0_role_type | String | originator |
| attribute | NC_GLOBAL | people_1_affiliation | String | University of Tennessee Knoxville |
| attribute | NC_GLOBAL | people_1_affiliation_acronym | String | UTK |
| attribute | NC_GLOBAL | people_1_person_name | String | Dr Andrew Steen |
| attribute | NC_GLOBAL | people_1_person_nid | String | 554160 |
| attribute | NC_GLOBAL | people_1_role | String | Co-Principal Investigator |
| attribute | NC_GLOBAL | people_1_role_type | String | originator |
| attribute | NC_GLOBAL | people_2_affiliation | String | University of Tennessee Knoxville |
| attribute | NC_GLOBAL | people_2_affiliation_acronym | String | UTK |
| attribute | NC_GLOBAL | people_2_person_name | String | Dr Karen G. Lloyd |
| attribute | NC_GLOBAL | people_2_person_nid | String | 639420 |
| attribute | NC_GLOBAL | people_2_role | String | Contact |
| attribute | NC_GLOBAL | people_2_role_type | String | related |
| attribute | NC_GLOBAL | people_3_affiliation | String | Woods Hole Oceanographic Institution |
| attribute | NC_GLOBAL | people_3_affiliation_acronym | String | WHOI BCO-DMO |
| attribute | NC_GLOBAL | people_3_person_name | String | Stephen R. Gegg |
| attribute | NC_GLOBAL | people_3_person_nid | String | 50910 |
| attribute | NC_GLOBAL | people_3_role | String | BCO-DMO Data Manager |
| attribute | NC_GLOBAL | people_3_role_type | String | related |
| attribute | NC_GLOBAL | project | String | IODP-347 Microbial Quantification |
| attribute | NC_GLOBAL | projects_0_acronym | String | IODP-347 Microbial Quantification |
| attribute | NC_GLOBAL | projects_0_description | String | Marine sediments contain a microbial population large enough to rival that of Earth's oceans, but much about this vast community is unknown. Innovations in total cell counting methods have refined estimates of cell concentrations, but tell us nothing about specific taxa. Isotopic data provides evidence that a majority of subsurface microorganisms survive by breaking down organic matter, yet measurable links between specific microbial taxa and their organic matter substrates are untested. The proposed work overcomes these limitations, with a particular focus on the degradation of proteins and carbohydrates, which comprise the bulk of classifiable sedimentary organic matter. The project will link specific taxa to potential extracellular enzyme activity in the genomes of single microbial cells, apply newly-identified, optimal methods for counting viable cells belonging to specific taxa using catalyzed reporter deposition fluorescent in situ hybridization (CARD-FISH), and measure the potential activity of their enzymes in situ. The resulting data will provide key evidence about the strategies subsurface life uses to overcome extreme energy limitation and contribute to the long-term carbon cycle. The Principal Investigators are employing novel,improved methods to quantify cells of specific taxa in the marine subsurface and to determine the biogeochemical functions of those uncultured taxa, including: 1) Determine the pathway of organic carbon degradation in single cell genomes of uncultured, numerically dominant subsurface microorganisms. 2) Quantify viable bacteria and archaea in the deep subsurface using an improvement on the existing technology of CARD-FISH. 3 )Measure the potential activities (Vmax values) of enzymes in deep Baltic Sea sediments, and use the abundances of enzyme-producing microorganisms to calculate depth profiles of cell-specific Vmax values. The project combines these methods in order to identify and quantify the cells capable of degrading organic matter in deep sediments of the Baltic Sea, obtained from Integrated Ocean Drilling Program (IODP) expedition 347. These results will greatly expand our knowledge of the function and activity of uncultured microorganisms in the deep subsurface. This project is associated with C-DEBI account number 157595. |
| attribute | NC_GLOBAL | projects_0_end_date | String | 2016-08 |
| attribute | NC_GLOBAL | projects_0_geolocation | String | Baltic Sea |
| attribute | NC_GLOBAL | projects_0_name | String | Quantifying the contribution of the deep biosphere in the marine sediment carbon cycle using deep-sea sediment cores from the Baltic Sea |
| attribute | NC_GLOBAL | projects_0_project_nid | String | 639417 |
| attribute | NC_GLOBAL | projects_0_start_date | String | 2014-09 |
| attribute | NC_GLOBAL | publisher_name | String | Biological and Chemical Oceanographic Data Management Office (BCO-DMO) |
| attribute | NC_GLOBAL | publisher_type | String | institution |
| attribute | NC_GLOBAL | sourceUrl | String | (local files) |
| attribute | NC_GLOBAL | Southernmost_Northing | double | 55.00483 |
| attribute | NC_GLOBAL | standard_name_vocabulary | String | CF Standard Name Table v55 |
| attribute | NC_GLOBAL | summary | String | Quantitative PCR data from sediment samples Locations: Site 59C (Little Belt); Site 60B (Anholt Loch); 63E (Landsort Deep); 65C (Bornholm Basin). Subsurface samples as deep as 85 meters below the Baltic Sea floor. |
| attribute | NC_GLOBAL | title | String | [qPCR] - Quantitative PCR data from sediment samples from MPSV GREATSHIP MANISHA IODP-347 cruise in the Baltic Sea in 2013 (IODP-347 Microbial Quantification project) (Quantifying the contribution of the deep biosphere in the marine sediment carbon cycle using deep-sea sediment cores from the Baltic Sea) |
| attribute | NC_GLOBAL | version | String | 1 |
| attribute | NC_GLOBAL | Westernmost_Easting | double | 10.107828 |
| attribute | NC_GLOBAL | xml_source | String | osprey2erddap.update_xml() v1.3 |
| variable | Identifier | String | ||
| attribute | Identifier | bcodmo_name | String | sample |
| attribute | Identifier | description | String | Sample Identifier |
| attribute | Identifier | long_name | String | Identifier |
| attribute | Identifier | nerc_identifier | String | https://vocab.nerc.ac.uk/collection/P02/current/ACYC/![]() |
| attribute | Identifier | units | String | text |
| variable | latitude | double | ||
| attribute | latitude | _CoordinateAxisType | String | Lat |
| attribute | latitude | _FillValue | double | NaN |
| attribute | latitude | actual_range | double | 55.00483, 58.622167 |
| attribute | latitude | axis | String | Y |
| attribute | latitude | bcodmo_name | String | latitude |
| attribute | latitude | colorBarMaximum | double | 90.0 |
| attribute | latitude | colorBarMinimum | double | -90.0 |
| attribute | latitude | description | String | Site Latitude (South is negative) |
| attribute | latitude | ioos_category | String | Location |
| attribute | latitude | long_name | String | Latitude |
| attribute | latitude | nerc_identifier | String | https://vocab.nerc.ac.uk/collection/P09/current/LATX/![]() |
| attribute | latitude | standard_name | String | latitude |
| attribute | latitude | units | String | degrees_north |
| variable | longitude | double | ||
| attribute | longitude | _CoordinateAxisType | String | Lon |
| attribute | longitude | _FillValue | double | NaN |
| attribute | longitude | actual_range | double | 10.107828, 18.254 |
| attribute | longitude | axis | String | X |
| attribute | longitude | bcodmo_name | String | longitude |
| attribute | longitude | colorBarMaximum | double | 180.0 |
| attribute | longitude | colorBarMinimum | double | -180.0 |
| attribute | longitude | description | String | Site Longitude (West is negative) |
| attribute | longitude | ioos_category | String | Location |
| attribute | longitude | long_name | String | Longitude |
| attribute | longitude | nerc_identifier | String | https://vocab.nerc.ac.uk/collection/P09/current/LONX/![]() |
| attribute | longitude | standard_name | String | longitude |
| attribute | longitude | units | String | degrees_east |
| variable | Depth | float | ||
| attribute | Depth | _FillValue | float | NaN |
| attribute | Depth | actual_range | float | 1.1, 84.42 |
| attribute | Depth | bcodmo_name | String | depth_core |
| attribute | Depth | colorBarMaximum | double | 8000.0 |
| attribute | Depth | colorBarMinimum | double | -8000.0 |
| attribute | Depth | colorBarPalette | String | TopographyDepth |
| attribute | Depth | description | String | Depth of sample in core |
| attribute | Depth | long_name | String | Depth |
| attribute | Depth | standard_name | String | depth |
| attribute | Depth | units | String | meters |
| variable | Archaea_replicate_1 | float | ||
| attribute | Archaea_replicate_1 | _FillValue | float | NaN |
| attribute | Archaea_replicate_1 | actual_range | float | 11500.0, 1.66E7 |
| attribute | Archaea_replicate_1 | bcodmo_name | String | unknown |
| attribute | Archaea_replicate_1 | description | String | Archaea replicate 1 (Units are copies of target DNA per microliter of DNA) |
| attribute | Archaea_replicate_1 | long_name | String | Archaea Replicate 1 |
| attribute | Archaea_replicate_1 | units | String | copies/uL |
| variable | Archaea_replicate_2 | float | ||
| attribute | Archaea_replicate_2 | _FillValue | float | NaN |
| attribute | Archaea_replicate_2 | actual_range | float | 12800.0, 2.28E7 |
| attribute | Archaea_replicate_2 | bcodmo_name | String | unknown |
| attribute | Archaea_replicate_2 | description | String | Archaea replicate 2 (Units are copies of target DNA per microliter of DNA) |
| attribute | Archaea_replicate_2 | long_name | String | Archaea Replicate 2 |
| attribute | Archaea_replicate_2 | units | String | copies/uL |
| variable | Bacteria_replicate_1 | float | ||
| attribute | Bacteria_replicate_1 | _FillValue | float | NaN |
| attribute | Bacteria_replicate_1 | actual_range | float | 1160000.0, 1.63E8 |
| attribute | Bacteria_replicate_1 | bcodmo_name | String | unknown |
| attribute | Bacteria_replicate_1 | description | String | Bacteria replicate 1 (Units are copies of target DNA per microliter of DNA) |
| attribute | Bacteria_replicate_1 | long_name | String | Bacteria Replicate 1 |
| attribute | Bacteria_replicate_1 | units | String | copies/uL |
| variable | Bacteria_replicate_2 | float | ||
| attribute | Bacteria_replicate_2 | _FillValue | float | NaN |
| attribute | Bacteria_replicate_2 | actual_range | float | 1180000.0, 1.46E8 |
| attribute | Bacteria_replicate_2 | bcodmo_name | String | unknown |
| attribute | Bacteria_replicate_2 | description | String | Bacteria replicate 2 (Units are copies of target DNA per microliter of DNA) |
| attribute | Bacteria_replicate_2 | long_name | String | Bacteria Replicate 2 |
| attribute | Bacteria_replicate_2 | units | String | copies/uL |
| variable | ANME1_replicate_1 | float | ||
| attribute | ANME1_replicate_1 | _FillValue | float | NaN |
| attribute | ANME1_replicate_1 | actual_range | float | 204000.0, 847000.0 |
| attribute | ANME1_replicate_1 | bcodmo_name | String | unknown |
| attribute | ANME1_replicate_1 | description | String | ANME1 replicate 1 (Units are copies of target DNA per microliter of DNA) |
| attribute | ANME1_replicate_1 | long_name | String | ANME1 Replicate 1 |
| attribute | ANME1_replicate_1 | units | String | copies/uL |
| variable | ANME1_replicate_2 | float | ||
| attribute | ANME1_replicate_2 | _FillValue | float | NaN |
| attribute | ANME1_replicate_2 | actual_range | float | 182000.0, 825000.0 |
| attribute | ANME1_replicate_2 | bcodmo_name | String | unknown |
| attribute | ANME1_replicate_2 | description | String | ANME1 replicate 2 (Units are copies of target DNA per microliter of DNA) |
| attribute | ANME1_replicate_2 | long_name | String | ANME1 Replicate 2 |
| attribute | ANME1_replicate_2 | units | String | copies/uL |
| variable | MCG_replicate_1 | float | ||
| attribute | MCG_replicate_1 | _FillValue | float | NaN |
| attribute | MCG_replicate_1 | actual_range | float | 6130.0, 2210000.0 |
| attribute | MCG_replicate_1 | bcodmo_name | String | unknown |
| attribute | MCG_replicate_1 | description | String | MCG replicate 1 (Units are copies of target DNA per microliter of DNA) |
| attribute | MCG_replicate_1 | long_name | String | MCG Replicate 1 |
| attribute | MCG_replicate_1 | units | String | copies/uL |
| variable | MCG_replicate_2 | float | ||
| attribute | MCG_replicate_2 | _FillValue | float | NaN |
| attribute | MCG_replicate_2 | actual_range | float | 2660.0, 1670000.0 |
| attribute | MCG_replicate_2 | bcodmo_name | String | unknown |
| attribute | MCG_replicate_2 | description | String | MCG replicate 2 (Units are copies of target DNA per microliter of DNA) |
| attribute | MCG_replicate_2 | long_name | String | MCG Replicate 2 |
| attribute | MCG_replicate_2 | units | String | copies/uL |
The information in the table above is also available in other file formats (.csv, .htmlTable, .itx, .json, .jsonlCSV1, .jsonlCSV, .jsonlKVP, .mat, .nc, .nccsv, .tsv, .xhtml) via a RESTful web service.