ERDDAP > info > bcodmo_dataset_641358

Grid DAP Data	Sub- set	Table DAP Data	Make A Graph	W M S	Source Data Files	Acces- sible	Title	Sum- mary	FGDC, ISO, Metadata	Back- ground Info	RSS	E mail	Institution	Dataset ID
		data	graph		files	public	[qPCR] - Quantitative PCR data from sediment samples from MPSV GREATSHIP MANISHA IODP-347 cruise in the Baltic Sea in 2013 (IODP-347 Microbial Quantification project) (Quantifying the contribution of the deep biosphere in the marine sediment carbon cycle using deep-sea sediment cores from the Baltic Sea)		F   I   M	background			BCO-DMO	bcodmo_dataset_641358

The Dataset's Variables and Attributes

Row Type	Variable Name	Attribute Name	Data Type	Value
attribute	NC_GLOBAL	access_formats	String	.htmlTable,.csv,.json,.mat,.nc,.tsv,.esriCsv,.geoJson
attribute	NC_GLOBAL	acquisition_description	String	Sampling and Analytical Methodology: Genomic DNA was extracted from Baltic Sea Basin sediments using FastDNA\u00ae Spin Kit for Soil (MP Biomedicals). 16S rRNA gene copy numbers of targets were quantified with qPCR using the primers in the table in datasheet. Results of qPCR were rejected if the R2 of the standard curve was below 0.95, or if the melt curve showed evidence of primer dimers. SYBR green chemistry was used for all reactions, and Invitrogen mastermix was used for DNA copy number measurement on a BioRad iQ5 (Applied Biosystems, Foster City, California). Serial dilutions of full-length 16S rRNA gene PCR products from plasmids containing amplified partial 16S genes were used as standards. \u00a0 Primers Used: Primer name Sequence (5' - 3') Target Reference Bac340f TCCTACGGGAGGCAGCAGT Bacteria Nadkarni et al., 2002 Bac 515r CGTATTACCGCGGCTGCTGGCAC Bacteria Nadkarni et al., 2002 Arch915f GTGCTCCCCCGCCAATTCCT Archaea Kubo et al., 2012 Arch1059r GCCATGCACCWCCTCT Archaea Kubo et al., 2012 ANME1-628f GCT TTC AGG GAA TAC TGC ANME-1 Lloyd et al., 2011 ANME1-830r TCG CAG TAA TGC CAA CAC ANME-1 Lloyd et al., 2011 MCG528f CGGTAATACCAGCTCTCCGAG Kubo et al., 2012 MCG732r CGCGTTCTAGCCGACAGC Kubo et al., 2012 \u00a0 Primers used from the following publications: [Archaea of the Miscellaneous Crenarchaeotal Group are abundant, diverse and widespread in marine sediments](\\"http://dmoserv3.whoi.edu/data_docs/IODP_347/Archaea) [Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set](\\"http://dmoserv3.whoi.edu/data_docs/IODP_347/Determination) [Environmental evidence for net methane production and oxidation in putative ANaerobic MEthanotrophic (ANME) archaea](\\"http://dmoserv3.whoi.edu/data_docs/IODP_347/Environmental)
attribute	NC_GLOBAL	awards_0_award_nid	String	639416
attribute	NC_GLOBAL	awards_0_award_number	String	OCE-1431598
attribute	NC_GLOBAL	awards_0_data_url	String	http://www.nsf.gov/awardsearch/showAward.do?AwardNumber=1431598
attribute	NC_GLOBAL	awards_0_funder_name	String	NSF Division of Ocean Sciences
attribute	NC_GLOBAL	awards_0_funding_acronym	String	NSF OCE
attribute	NC_GLOBAL	awards_0_funding_source_nid	String	355
attribute	NC_GLOBAL	awards_0_program_manager	String	Dr Thomas Janecek
attribute	NC_GLOBAL	awards_0_program_manager_nid	String	511697
attribute	NC_GLOBAL	cdm_data_type	String	Other
attribute	NC_GLOBAL	comment	String	IODP-347 Quantitative PCR data from sediments PIs: Lloyd, Steen Version: 25 March 2016
attribute	NC_GLOBAL	Conventions	String	COARDS, CF-1.6, ACDD-1.3
attribute	NC_GLOBAL	creator_email	String	info at bco-dmo.org
attribute	NC_GLOBAL	creator_name	String	BCO-DMO
attribute	NC_GLOBAL	creator_type	String	institution
attribute	NC_GLOBAL	creator_url	String	https://www.bco-dmo.org/
attribute	NC_GLOBAL	data_source	String	extract_data_as_tsv version 2.3 19 Dec 2019
attribute	NC_GLOBAL	date_created	String	2016-03-25T14:34:56Z
attribute	NC_GLOBAL	date_modified	String	2016-11-15T18:15:09Z
attribute	NC_GLOBAL	defaultDataQuery	String	&time<now
attribute	NC_GLOBAL	doi	String	10.1575/1912/bco-dmo.664686
attribute	NC_GLOBAL	Easternmost_Easting	double	18.254
attribute	NC_GLOBAL	geospatial_lat_max	double	58.622167
attribute	NC_GLOBAL	geospatial_lat_min	double	55.00483
attribute	NC_GLOBAL	geospatial_lat_units	String	degrees_north
attribute	NC_GLOBAL	geospatial_lon_max	double	18.254
attribute	NC_GLOBAL	geospatial_lon_min	double	10.107828
attribute	NC_GLOBAL	geospatial_lon_units	String	degrees_east
attribute	NC_GLOBAL	infoUrl	String	https://www.bco-dmo.org/dataset/641358
attribute	NC_GLOBAL	institution	String	BCO-DMO
attribute	NC_GLOBAL	instruments_0_acronym	String	Thermal Cycler
attribute	NC_GLOBAL	instruments_0_dataset_instrument_description	String	Genomic DNA was extracted from Baltic Sea Basin sediments using FastDNA® Spin Kit for Soil (MP Biomedicals). 16S rRNA gene copy numbers of targets were quantified with qPCR using the primers in the table in datasheet. Results of qPCR were rejected if the R2 of the standard curve was below 0.95, or if the melt curve showed evidence of primer dimers. SYBR green chemistry was used for all reactions, and Invitrogen mastermix was used for DNA copy number measurement on a BioRad iQ5 (Applied Biosystems, Foster City, California). Serial dilutions of full-length 16S rRNA gene PCR products from plasmids containing amplified partial 16S genes were used as standards. BioRad iQ5
attribute	NC_GLOBAL	instruments_0_dataset_instrument_nid	String	641476
attribute	NC_GLOBAL	instruments_0_description	String	General term for a laboratory apparatus commonly used for performing polymerase chain reaction (PCR). The device has a thermal block with holes where tubes with the PCR reaction mixtures can be inserted. The cycler then raises and lowers the temperature of the block in discrete, pre-programmed steps. (adapted from http://serc.carleton.edu/microbelife/research_methods/genomics/pcr.html)
attribute	NC_GLOBAL	instruments_0_instrument_name	String	PCR Thermal Cycler
attribute	NC_GLOBAL	instruments_0_instrument_nid	String	471582
attribute	NC_GLOBAL	instruments_0_supplied_name	String	BioRad iQ5
attribute	NC_GLOBAL	instruments_1_acronym	String	Thermal Cycler
attribute	NC_GLOBAL	instruments_1_dataset_instrument_description	String	Genomic DNA was extracted from Baltic Sea Basin sediments using FastDNA® Spin Kit for Soil (MP Biomedicals). 16S rRNA gene copy numbers of targets were quantified with qPCR using the primers in the table in datasheet. Results of qPCR were rejected if the R2 of the standard curve was below 0.95, or if the melt curve showed evidence of primer dimers. SYBR green chemistry was used for all reactions, and Invitrogen mastermix was used for DNA copy number measurement on a BioRad iQ5 (Applied Biosystems, Foster City, California). Serial dilutions of full-length 16S rRNA gene PCR products from plasmids containing amplified partial 16S genes were used as standards. FastDNA® Spin Kit for Soil
attribute	NC_GLOBAL	instruments_1_dataset_instrument_nid	String	641477
attribute	NC_GLOBAL	instruments_1_description	String	General term for a laboratory apparatus commonly used for performing polymerase chain reaction (PCR). The device has a thermal block with holes where tubes with the PCR reaction mixtures can be inserted. The cycler then raises and lowers the temperature of the block in discrete, pre-programmed steps. (adapted from http://serc.carleton.edu/microbelife/research_methods/genomics/pcr.html)
attribute	NC_GLOBAL	instruments_1_instrument_name	String	PCR Thermal Cycler
attribute	NC_GLOBAL	instruments_1_instrument_nid	String	471582
attribute	NC_GLOBAL	instruments_1_supplied_name	String	FastDNA® Spin Kit for Soil
attribute	NC_GLOBAL	keywords	String	anme1, ANME1_replicate_1, ANME1_replicate_2, archaea, Archaea_replicate_1, Archaea_replicate_2, bacteria, Bacteria_replicate_1, Bacteria_replicate_2, bco, bco-dmo, biological, chemical, data, dataset, depth, dmo, erddap, identifier, latitude, longitude, management, mcg, MCG_replicate_1, MCG_replicate_2, oceanography, office, preliminary, replicate
attribute	NC_GLOBAL	license	String	https://www.bco-dmo.org/dataset/641358/license
attribute	NC_GLOBAL	metadata_source	String	https://www.bco-dmo.org/api/dataset/641358
attribute	NC_GLOBAL	Northernmost_Northing	double	58.622167
attribute	NC_GLOBAL	param_mapping	String	{'641358': {'Latitude': 'flag - latitude', 'Longitude': 'flag - longitude'}}
attribute	NC_GLOBAL	parameter_source	String	https://www.bco-dmo.org/mapserver/dataset/641358/parameters
attribute	NC_GLOBAL	people_0_affiliation	String	University of Tennessee Knoxville
attribute	NC_GLOBAL	people_0_affiliation_acronym	String	UTK
attribute	NC_GLOBAL	people_0_person_name	String	Dr Karen G. Lloyd
attribute	NC_GLOBAL	people_0_person_nid	String	639420
attribute	NC_GLOBAL	people_0_role	String	Principal Investigator
attribute	NC_GLOBAL	people_0_role_type	String	originator
attribute	NC_GLOBAL	people_1_affiliation	String	University of Tennessee Knoxville
attribute	NC_GLOBAL	people_1_affiliation_acronym	String	UTK
attribute	NC_GLOBAL	people_1_person_name	String	Dr Andrew Steen
attribute	NC_GLOBAL	people_1_person_nid	String	554160
attribute	NC_GLOBAL	people_1_role	String	Co-Principal Investigator
attribute	NC_GLOBAL	people_1_role_type	String	originator
attribute	NC_GLOBAL	people_2_affiliation	String	University of Tennessee Knoxville
attribute	NC_GLOBAL	people_2_affiliation_acronym	String	UTK
attribute	NC_GLOBAL	people_2_person_name	String	Dr Karen G. Lloyd
attribute	NC_GLOBAL	people_2_person_nid	String	639420
attribute	NC_GLOBAL	people_2_role	String	Contact
attribute	NC_GLOBAL	people_2_role_type	String	related
attribute	NC_GLOBAL	people_3_affiliation	String	Woods Hole Oceanographic Institution
attribute	NC_GLOBAL	people_3_affiliation_acronym	String	WHOI BCO-DMO
attribute	NC_GLOBAL	people_3_person_name	String	Stephen R. Gegg
attribute	NC_GLOBAL	people_3_person_nid	String	50910
attribute	NC_GLOBAL	people_3_role	String	BCO-DMO Data Manager
attribute	NC_GLOBAL	people_3_role_type	String	related
attribute	NC_GLOBAL	project	String	IODP-347 Microbial Quantification
attribute	NC_GLOBAL	projects_0_acronym	String	IODP-347 Microbial Quantification
attribute	NC_GLOBAL	projects_0_description	String	Marine sediments contain a microbial population large enough to rival that of Earth's oceans, but much about this vast community is unknown. Innovations in total cell counting methods have refined estimates of cell concentrations, but tell us nothing about specific taxa. Isotopic data provides evidence that a majority of subsurface microorganisms survive by breaking down organic matter, yet measurable links between specific microbial taxa and their organic matter substrates are untested. The proposed work overcomes these limitations, with a particular focus on the degradation of proteins and carbohydrates, which comprise the bulk of classifiable sedimentary organic matter. The project will link specific taxa to potential extracellular enzyme activity in the genomes of single microbial cells, apply newly-identified, optimal methods for counting viable cells belonging to specific taxa using catalyzed reporter deposition fluorescent in situ hybridization (CARD-FISH), and measure the potential activity of their enzymes in situ. The resulting data will provide key evidence about the strategies subsurface life uses to overcome extreme energy limitation and contribute to the long-term carbon cycle. The Principal Investigators are employing novel,improved methods to quantify cells of specific taxa in the marine subsurface and to determine the biogeochemical functions of those uncultured taxa, including: 1) Determine the pathway of organic carbon degradation in single cell genomes of uncultured, numerically dominant subsurface microorganisms. 2) Quantify viable bacteria and archaea in the deep subsurface using an improvement on the existing technology of CARD-FISH. 3 )Measure the potential activities (Vmax values) of enzymes in deep Baltic Sea sediments, and use the abundances of enzyme-producing microorganisms to calculate depth profiles of cell-specific Vmax values. The project combines these methods in order to identify and quantify the cells capable of degrading organic matter in deep sediments of the Baltic Sea, obtained from Integrated Ocean Drilling Program (IODP) expedition 347. These results will greatly expand our knowledge of the function and activity of uncultured microorganisms in the deep subsurface. This project is associated with C-DEBI account number 157595.
attribute	NC_GLOBAL	projects_0_end_date	String	2016-08
attribute	NC_GLOBAL	projects_0_geolocation	String	Baltic Sea
attribute	NC_GLOBAL	projects_0_name	String	Quantifying the contribution of the deep biosphere in the marine sediment carbon cycle using deep-sea sediment cores from the Baltic Sea
attribute	NC_GLOBAL	projects_0_project_nid	String	639417
attribute	NC_GLOBAL	projects_0_start_date	String	2014-09
attribute	NC_GLOBAL	publisher_name	String	Biological and Chemical Oceanographic Data Management Office (BCO-DMO)
attribute	NC_GLOBAL	publisher_type	String	institution
attribute	NC_GLOBAL	sourceUrl	String	(local files)
attribute	NC_GLOBAL	Southernmost_Northing	double	55.00483
attribute	NC_GLOBAL	standard_name_vocabulary	String	CF Standard Name Table v55
attribute	NC_GLOBAL	summary	String	Quantitative PCR data from sediment samples Locations: Site 59C (Little Belt); Site 60B (Anholt Loch); 63E (Landsort Deep); 65C (Bornholm Basin). Subsurface samples as deep as 85 meters below the Baltic Sea floor.
attribute	NC_GLOBAL	title	String	[qPCR] - Quantitative PCR data from sediment samples from MPSV GREATSHIP MANISHA IODP-347 cruise in the Baltic Sea in 2013 (IODP-347 Microbial Quantification project) (Quantifying the contribution of the deep biosphere in the marine sediment carbon cycle using deep-sea sediment cores from the Baltic Sea)
attribute	NC_GLOBAL	version	String	1
attribute	NC_GLOBAL	Westernmost_Easting	double	10.107828
attribute	NC_GLOBAL	xml_source	String	osprey2erddap.update_xml() v1.3
variable	Identifier		String
attribute	Identifier	bcodmo_name	String	sample
attribute	Identifier	description	String	Sample Identifier
attribute	Identifier	long_name	String	Identifier
attribute	Identifier	nerc_identifier	String	https://vocab.nerc.ac.uk/collection/P02/current/ACYC/
attribute	Identifier	units	String	text
variable	latitude		double
attribute	latitude	_CoordinateAxisType	String	Lat
attribute	latitude	_FillValue	double	NaN
attribute	latitude	actual_range	double	55.00483, 58.622167
attribute	latitude	axis	String	Y
attribute	latitude	bcodmo_name	String	latitude
attribute	latitude	colorBarMaximum	double	90.0
attribute	latitude	colorBarMinimum	double	-90.0
attribute	latitude	description	String	Site Latitude (South is negative)
attribute	latitude	ioos_category	String	Location
attribute	latitude	long_name	String	Latitude
attribute	latitude	nerc_identifier	String	https://vocab.nerc.ac.uk/collection/P09/current/LATX/
attribute	latitude	standard_name	String	latitude
attribute	latitude	units	String	degrees_north
variable	longitude		double
attribute	longitude	_CoordinateAxisType	String	Lon
attribute	longitude	_FillValue	double	NaN
attribute	longitude	actual_range	double	10.107828, 18.254
attribute	longitude	axis	String	X
attribute	longitude	bcodmo_name	String	longitude
attribute	longitude	colorBarMaximum	double	180.0
attribute	longitude	colorBarMinimum	double	-180.0
attribute	longitude	description	String	Site Longitude (West is negative)
attribute	longitude	ioos_category	String	Location
attribute	longitude	long_name	String	Longitude
attribute	longitude	nerc_identifier	String	https://vocab.nerc.ac.uk/collection/P09/current/LONX/
attribute	longitude	standard_name	String	longitude
attribute	longitude	units	String	degrees_east
variable	Depth		float
attribute	Depth	_FillValue	float	NaN
attribute	Depth	actual_range	float	1.1, 84.42
attribute	Depth	bcodmo_name	String	depth_core
attribute	Depth	colorBarMaximum	double	8000.0
attribute	Depth	colorBarMinimum	double	-8000.0
attribute	Depth	colorBarPalette	String	TopographyDepth
attribute	Depth	description	String	Depth of sample in core
attribute	Depth	long_name	String	Depth
attribute	Depth	standard_name	String	depth
attribute	Depth	units	String	meters
variable	Archaea_replicate_1		float
attribute	Archaea_replicate_1	_FillValue	float	NaN
attribute	Archaea_replicate_1	actual_range	float	11500.0, 1.66E7
attribute	Archaea_replicate_1	bcodmo_name	String	unknown
attribute	Archaea_replicate_1	description	String	Archaea replicate 1 (Units are copies of target DNA per microliter of DNA)
attribute	Archaea_replicate_1	long_name	String	Archaea Replicate 1
attribute	Archaea_replicate_1	units	String	copies/uL
variable	Archaea_replicate_2		float
attribute	Archaea_replicate_2	_FillValue	float	NaN
attribute	Archaea_replicate_2	actual_range	float	12800.0, 2.28E7
attribute	Archaea_replicate_2	bcodmo_name	String	unknown
attribute	Archaea_replicate_2	description	String	Archaea replicate 2 (Units are copies of target DNA per microliter of DNA)
attribute	Archaea_replicate_2	long_name	String	Archaea Replicate 2
attribute	Archaea_replicate_2	units	String	copies/uL
variable	Bacteria_replicate_1		float
attribute	Bacteria_replicate_1	_FillValue	float	NaN
attribute	Bacteria_replicate_1	actual_range	float	1160000.0, 1.63E8
attribute	Bacteria_replicate_1	bcodmo_name	String	unknown
attribute	Bacteria_replicate_1	description	String	Bacteria replicate 1 (Units are copies of target DNA per microliter of DNA)
attribute	Bacteria_replicate_1	long_name	String	Bacteria Replicate 1
attribute	Bacteria_replicate_1	units	String	copies/uL
variable	Bacteria_replicate_2		float
attribute	Bacteria_replicate_2	_FillValue	float	NaN
attribute	Bacteria_replicate_2	actual_range	float	1180000.0, 1.46E8
attribute	Bacteria_replicate_2	bcodmo_name	String	unknown
attribute	Bacteria_replicate_2	description	String	Bacteria replicate 2 (Units are copies of target DNA per microliter of DNA)
attribute	Bacteria_replicate_2	long_name	String	Bacteria Replicate 2
attribute	Bacteria_replicate_2	units	String	copies/uL
variable	ANME1_replicate_1		float
attribute	ANME1_replicate_1	_FillValue	float	NaN
attribute	ANME1_replicate_1	actual_range	float	204000.0, 847000.0
attribute	ANME1_replicate_1	bcodmo_name	String	unknown
attribute	ANME1_replicate_1	description	String	ANME1 replicate 1 (Units are copies of target DNA per microliter of DNA)
attribute	ANME1_replicate_1	long_name	String	ANME1 Replicate 1
attribute	ANME1_replicate_1	units	String	copies/uL
variable	ANME1_replicate_2		float
attribute	ANME1_replicate_2	_FillValue	float	NaN
attribute	ANME1_replicate_2	actual_range	float	182000.0, 825000.0
attribute	ANME1_replicate_2	bcodmo_name	String	unknown
attribute	ANME1_replicate_2	description	String	ANME1 replicate 2 (Units are copies of target DNA per microliter of DNA)
attribute	ANME1_replicate_2	long_name	String	ANME1 Replicate 2
attribute	ANME1_replicate_2	units	String	copies/uL
variable	MCG_replicate_1		float
attribute	MCG_replicate_1	_FillValue	float	NaN
attribute	MCG_replicate_1	actual_range	float	6130.0, 2210000.0
attribute	MCG_replicate_1	bcodmo_name	String	unknown
attribute	MCG_replicate_1	description	String	MCG replicate 1 (Units are copies of target DNA per microliter of DNA)
attribute	MCG_replicate_1	long_name	String	MCG Replicate 1
attribute	MCG_replicate_1	units	String	copies/uL
variable	MCG_replicate_2		float
attribute	MCG_replicate_2	_FillValue	float	NaN
attribute	MCG_replicate_2	actual_range	float	2660.0, 1670000.0
attribute	MCG_replicate_2	bcodmo_name	String	unknown
attribute	MCG_replicate_2	description	String	MCG replicate 2 (Units are copies of target DNA per microliter of DNA)
attribute	MCG_replicate_2	long_name	String	MCG Replicate 2
attribute	MCG_replicate_2	units	String	copies/uL

The information in the table above is also available in other file formats (.csv, .htmlTable, .itx, .json, .jsonlCSV1, .jsonlCSV, .jsonlKVP, .mat, .nc, .nccsv, .tsv, .xhtml) via a RESTful web service.