|
BCO-DMO ERDDAP
Accessing BCO-DMO data |
log in
Brought to you by BCO-DMO |
| Dataset Title: | [qPCR] - Quantitative PCR data from sediment samples from MPSV GREATSHIP MANISHA IODP-347 cruise in the Baltic Sea in 2013 (IODP-347 Microbial Quantification project) (Quantifying the contribution of the deep biosphere in the marine sediment carbon cycle using deep-sea sediment cores from the Baltic Sea)
|
| Institution: | BCO-DMO (Dataset ID: bcodmo_dataset_641358) |
| Information: | Summary
| License
| FGDC
| ISO 19115
| Metadata
| Background
| Files
| Make a graph
|
Attributes {
s {
Identifier {
String bcodmo_name "sample";
String description "Sample Identifier";
String long_name "Identifier";
String nerc_identifier "https://vocab.nerc.ac.uk/collection/P02/current/ACYC/";
String units "text";
}
latitude {
String _CoordinateAxisType "Lat";
Float64 _FillValue NaN;
Float64 actual_range 55.00483, 58.622167;
String axis "Y";
String bcodmo_name "latitude";
Float64 colorBarMaximum 90.0;
Float64 colorBarMinimum -90.0;
String description "Site Latitude (South is negative)";
String ioos_category "Location";
String long_name "Latitude";
String nerc_identifier "https://vocab.nerc.ac.uk/collection/P09/current/LATX/";
String standard_name "latitude";
String units "degrees_north";
}
longitude {
String _CoordinateAxisType "Lon";
Float64 _FillValue NaN;
Float64 actual_range 10.107828, 18.254;
String axis "X";
String bcodmo_name "longitude";
Float64 colorBarMaximum 180.0;
Float64 colorBarMinimum -180.0;
String description "Site Longitude (West is negative)";
String ioos_category "Location";
String long_name "Longitude";
String nerc_identifier "https://vocab.nerc.ac.uk/collection/P09/current/LONX/";
String standard_name "longitude";
String units "degrees_east";
}
Depth {
Float32 _FillValue NaN;
Float32 actual_range 1.1, 84.42;
String bcodmo_name "depth_core";
Float64 colorBarMaximum 8000.0;
Float64 colorBarMinimum -8000.0;
String colorBarPalette "TopographyDepth";
String description "Depth of sample in core";
String long_name "Depth";
String standard_name "depth";
String units "meters";
}
Archaea_replicate_1 {
Float32 _FillValue NaN;
Float32 actual_range 11500.0, 1.66e+7;
String bcodmo_name "unknown";
String description "Archaea replicate 1 (Units are copies of target DNA per microliter of DNA)";
String long_name "Archaea Replicate 1";
String units "copies/uL";
}
Archaea_replicate_2 {
Float32 _FillValue NaN;
Float32 actual_range 12800.0, 2.28e+7;
String bcodmo_name "unknown";
String description "Archaea replicate 2 (Units are copies of target DNA per microliter of DNA)";
String long_name "Archaea Replicate 2";
String units "copies/uL";
}
Bacteria_replicate_1 {
Float32 _FillValue NaN;
Float32 actual_range 1160000.0, 1.63e+8;
String bcodmo_name "unknown";
String description "Bacteria replicate 1 (Units are copies of target DNA per microliter of DNA)";
String long_name "Bacteria Replicate 1";
String units "copies/uL";
}
Bacteria_replicate_2 {
Float32 _FillValue NaN;
Float32 actual_range 1180000.0, 1.46e+8;
String bcodmo_name "unknown";
String description "Bacteria replicate 2 (Units are copies of target DNA per microliter of DNA)";
String long_name "Bacteria Replicate 2";
String units "copies/uL";
}
ANME1_replicate_1 {
Float32 _FillValue NaN;
Float32 actual_range 204000.0, 847000.0;
String bcodmo_name "unknown";
String description "ANME1 replicate 1 (Units are copies of target DNA per microliter of DNA)";
String long_name "ANME1 Replicate 1";
String units "copies/uL";
}
ANME1_replicate_2 {
Float32 _FillValue NaN;
Float32 actual_range 182000.0, 825000.0;
String bcodmo_name "unknown";
String description "ANME1 replicate 2 (Units are copies of target DNA per microliter of DNA)";
String long_name "ANME1 Replicate 2";
String units "copies/uL";
}
MCG_replicate_1 {
Float32 _FillValue NaN;
Float32 actual_range 6130.0, 2210000.0;
String bcodmo_name "unknown";
String description "MCG replicate 1 (Units are copies of target DNA per microliter of DNA)";
String long_name "MCG Replicate 1";
String units "copies/uL";
}
MCG_replicate_2 {
Float32 _FillValue NaN;
Float32 actual_range 2660.0, 1670000.0;
String bcodmo_name "unknown";
String description "MCG replicate 2 (Units are copies of target DNA per microliter of DNA)";
String long_name "MCG Replicate 2";
String units "copies/uL";
}
}
NC_GLOBAL {
String access_formats ".htmlTable,.csv,.json,.mat,.nc,.tsv,.esriCsv,.geoJson";
String acquisition_description
"Sampling and Analytical Methodology:
Genomic DNA was extracted from Baltic Sea Basin sediments using
FastDNA\\u00ae Spin Kit for Soil
(MP Biomedicals). 16S rRNA gene copy numbers of targets were quantified with
qPCR using the
primers in the table in datasheet. Results of qPCR were rejected if the R2
of the standard curve was
below 0.95, or if the melt curve showed evidence of primer dimers. SYBR
green chemistry was used
for all reactions, and Invitrogen mastermix was used for DNA copy number
measurement on a
BioRad iQ5 (Applied Biosystems, Foster City, California). Serial dilutions
of full-length 16S rRNA
gene PCR products from plasmids containing amplified partial 16S genes were
used as standards.
\\u00a0
Primers Used:
Primer name Sequence (5' - 3') Target Reference Bac340f TCCTACGGGAGGCAGCAGT Bacteria Nadkarni et al., 2002 Bac 515r CGTATTACCGCGGCTGCTGGCAC Bacteria Nadkarni et al., 2002 Arch915f GTGCTCCCCCGCCAATTCCT Archaea Kubo et al., 2012 Arch1059r GCCATGCACCWCCTCT Archaea Kubo et al., 2012 ANME1-628f GCT TTC AGG GAA TAC TGC ANME-1 Lloyd et al., 2011 ANME1-830r TCG CAG TAA TGC CAA CAC ANME-1 Lloyd et al., 2011 MCG528f CGGTAATACCAGCTCTCCGAG Kubo et al., 2012 MCG732r CGCGTTCTAGCCGACAGC Kubo et al., 2012
\\u00a0
Primers used from the following publications:
[Archaea of the Miscellaneous Crenarchaeotal Group are abundant, diverse and
widespread in marine
sediments](\\\\\"http://dmoserv3.whoi.edu/data_docs/IODP_347/Archaea)
[Determination of bacterial load by real-time PCR using a broad-range
(universal) probe and primers
set](\\\\\"http://dmoserv3.whoi.edu/data_docs/IODP_347/Determination)
[Environmental evidence for net methane production and oxidation in putative
ANaerobic MEthanotrophic (ANME)
archaea](\\\\\"http://dmoserv3.whoi.edu/data_docs/IODP_347/Environmental)";
String awards_0_award_nid "639416";
String awards_0_award_number "OCE-1431598";
String awards_0_data_url "http://www.nsf.gov/awardsearch/showAward.do?AwardNumber=1431598";
String awards_0_funder_name "NSF Division of Ocean Sciences";
String awards_0_funding_acronym "NSF OCE";
String awards_0_funding_source_nid "355";
String awards_0_program_manager "Dr Thomas Janecek";
String awards_0_program_manager_nid "511697";
String cdm_data_type "Other";
String comment
"IODP-347 Quantitative PCR data from sediments
PIs: Lloyd, Steen
Version: 25 March 2016";
String Conventions "COARDS, CF-1.6, ACDD-1.3";
String creator_email "info@bco-dmo.org";
String creator_name "BCO-DMO";
String creator_type "institution";
String creator_url "https://www.bco-dmo.org/";
String data_source "extract_data_as_tsv version 2.3 19 Dec 2019";
String date_created "2016-03-25T14:34:56Z";
String date_modified "2016-11-15T18:15:09Z";
String defaultDataQuery "&time<now";
String doi "10.1575/1912/bco-dmo.664686";
Float64 Easternmost_Easting 18.254;
Float64 geospatial_lat_max 58.622167;
Float64 geospatial_lat_min 55.00483;
String geospatial_lat_units "degrees_north";
Float64 geospatial_lon_max 18.254;
Float64 geospatial_lon_min 10.107828;
String geospatial_lon_units "degrees_east";
String history
"2026-07-23T05:55:21Z (local files)
2026-07-23T05:55:21Z https://erddap.bco-dmo.org/erddap/tabledap/bcodmo_dataset_641358.html";
String infoUrl "https://www.bco-dmo.org/dataset/641358";
String institution "BCO-DMO";
String instruments_0_acronym "Thermal Cycler";
String instruments_0_dataset_instrument_description
"Genomic DNA was extracted from Baltic Sea Basin sediments using FastDNA® Spin Kit for Soil
(MP Biomedicals). 16S rRNA gene copy numbers of targets were quantified with qPCR using the
primers in the table in datasheet. Results of qPCR were rejected if the R2 of the standard curve was
below 0.95, or if the melt curve showed evidence of primer dimers. SYBR green chemistry was used
for all reactions, and Invitrogen mastermix was used for DNA copy number measurement on a
BioRad iQ5 (Applied Biosystems, Foster City, California). Serial dilutions of full-length 16S rRNA
gene PCR products from plasmids containing amplified partial 16S genes were used as standards.
BioRad iQ5";
String instruments_0_dataset_instrument_nid "641476";
String instruments_0_description
"General term for a laboratory apparatus commonly used for performing polymerase chain reaction (PCR). The device has a thermal block with holes where tubes with the PCR reaction mixtures can be inserted. The cycler then raises and lowers the temperature of the block in discrete, pre-programmed steps.
(adapted from http://serc.carleton.edu/microbelife/research_methods/genomics/pcr.html)";
String instruments_0_instrument_name "PCR Thermal Cycler";
String instruments_0_instrument_nid "471582";
String instruments_0_supplied_name "BioRad iQ5";
String instruments_1_acronym "Thermal Cycler";
String instruments_1_dataset_instrument_description
"Genomic DNA was extracted from Baltic Sea Basin sediments using FastDNA® Spin Kit for Soil
(MP Biomedicals). 16S rRNA gene copy numbers of targets were quantified with qPCR using the
primers in the table in datasheet. Results of qPCR were rejected if the R2 of the standard curve was
below 0.95, or if the melt curve showed evidence of primer dimers. SYBR green chemistry was used
for all reactions, and Invitrogen mastermix was used for DNA copy number measurement on a
BioRad iQ5 (Applied Biosystems, Foster City, California). Serial dilutions of full-length 16S rRNA
gene PCR products from plasmids containing amplified partial 16S genes were used as standards.
FastDNA® Spin Kit for Soil";
String instruments_1_dataset_instrument_nid "641477";
String instruments_1_description
"General term for a laboratory apparatus commonly used for performing polymerase chain reaction (PCR). The device has a thermal block with holes where tubes with the PCR reaction mixtures can be inserted. The cycler then raises and lowers the temperature of the block in discrete, pre-programmed steps.
(adapted from http://serc.carleton.edu/microbelife/research_methods/genomics/pcr.html)";
String instruments_1_instrument_name "PCR Thermal Cycler";
String instruments_1_instrument_nid "471582";
String instruments_1_supplied_name "FastDNA® Spin Kit for Soil";
String keywords "anme1, ANME1_replicate_1, ANME1_replicate_2, archaea, Archaea_replicate_1, Archaea_replicate_2, bacteria, Bacteria_replicate_1, Bacteria_replicate_2, bco, bco-dmo, biological, chemical, data, dataset, depth, dmo, erddap, identifier, latitude, longitude, management, mcg, MCG_replicate_1, MCG_replicate_2, oceanography, office, preliminary, replicate";
String license "https://www.bco-dmo.org/dataset/641358/license";
String metadata_source "https://www.bco-dmo.org/api/dataset/641358";
Float64 Northernmost_Northing 58.622167;
String param_mapping "{'641358': {'Latitude': 'flag - latitude', 'Longitude': 'flag - longitude'}}";
String parameter_source "https://www.bco-dmo.org/mapserver/dataset/641358/parameters";
String people_0_affiliation "University of Tennessee Knoxville";
String people_0_affiliation_acronym "UTK";
String people_0_person_name "Dr Karen G. Lloyd";
String people_0_person_nid "639420";
String people_0_role "Principal Investigator";
String people_0_role_type "originator";
String people_1_affiliation "University of Tennessee Knoxville";
String people_1_affiliation_acronym "UTK";
String people_1_person_name "Dr Andrew Steen";
String people_1_person_nid "554160";
String people_1_role "Co-Principal Investigator";
String people_1_role_type "originator";
String people_2_affiliation "University of Tennessee Knoxville";
String people_2_affiliation_acronym "UTK";
String people_2_person_name "Dr Karen G. Lloyd";
String people_2_person_nid "639420";
String people_2_role "Contact";
String people_2_role_type "related";
String people_3_affiliation "Woods Hole Oceanographic Institution";
String people_3_affiliation_acronym "WHOI BCO-DMO";
String people_3_person_name "Stephen R. Gegg";
String people_3_person_nid "50910";
String people_3_role "BCO-DMO Data Manager";
String people_3_role_type "related";
String project "IODP-347 Microbial Quantification";
String projects_0_acronym "IODP-347 Microbial Quantification";
String projects_0_description
"Marine sediments contain a microbial population large enough to rival that of Earth's oceans, but much about this vast community is unknown. Innovations in total cell counting methods have refined estimates of cell concentrations, but tell us nothing about specific taxa. Isotopic data provides evidence that a majority of subsurface microorganisms survive by breaking down organic matter, yet measurable links between specific microbial taxa and their organic matter substrates are untested. The proposed work overcomes these limitations, with a particular focus on the degradation of proteins and carbohydrates, which comprise the bulk of classifiable sedimentary organic matter. The project will link specific taxa to potential extracellular enzyme activity in the genomes of single microbial cells, apply newly-identified, optimal methods for counting viable cells belonging to specific taxa using catalyzed reporter deposition fluorescent in situ hybridization (CARD-FISH), and measure the potential activity of their enzymes in situ. The resulting data will provide key evidence about the strategies subsurface life uses to overcome extreme energy limitation and contribute to the long-term carbon cycle.
The Principal Investigators are employing novel,improved methods to quantify cells of specific taxa in the marine subsurface and to determine the biogeochemical functions of those uncultured taxa, including:
1) Determine the pathway of organic carbon degradation in single cell genomes of uncultured, numerically dominant subsurface microorganisms.
2) Quantify viable bacteria and archaea in the deep subsurface using an improvement on the existing technology of CARD-FISH.
3 )Measure the potential activities (Vmax values) of enzymes in deep Baltic Sea sediments, and use the abundances of enzyme-producing microorganisms to calculate depth profiles of cell-specific Vmax values.
The project combines these methods in order to identify and quantify the cells capable of degrading organic matter in deep sediments of the Baltic Sea, obtained from Integrated Ocean Drilling Program (IODP) expedition 347. These results will greatly expand our knowledge of the function and activity of uncultured microorganisms in the deep subsurface.
This project is associated with C-DEBI account number 157595.";
String projects_0_end_date "2016-08";
String projects_0_geolocation "Baltic Sea";
String projects_0_name "Quantifying the contribution of the deep biosphere in the marine sediment carbon cycle using deep-sea sediment cores from the Baltic Sea";
String projects_0_project_nid "639417";
String projects_0_start_date "2014-09";
String publisher_name "Biological and Chemical Oceanographic Data Management Office (BCO-DMO)";
String publisher_type "institution";
String sourceUrl "(local files)";
Float64 Southernmost_Northing 55.00483;
String standard_name_vocabulary "CF Standard Name Table v55";
String summary
"Quantitative PCR data from sediment samples
Locations:
Site 59C (Little Belt); Site 60B (Anholt Loch); 63E (Landsort Deep); 65C
(Bornholm Basin).
Subsurface samples as deep as 85 meters below the Baltic Sea floor.";
String title "[qPCR] - Quantitative PCR data from sediment samples from MPSV GREATSHIP MANISHA IODP-347 cruise in the Baltic Sea in 2013 (IODP-347 Microbial Quantification project) (Quantifying the contribution of the deep biosphere in the marine sediment carbon cycle using deep-sea sediment cores from the Baltic Sea)";
String version "1";
Float64 Westernmost_Easting 10.107828;
String xml_source "osprey2erddap.update_xml() v1.3";
}
}
Data Access Protocol (DAP)
and its
selection constraints
.
The URL specifies what you want: the dataset, a description of the graph or the subset of the data, and the file type for the response.
Tabledap request URLs must be in the form
https://coastwatch.pfeg.noaa.gov/erddap/tabledap/datasetID.fileType{?query}
For example,
https://coastwatch.pfeg.noaa.gov/erddap/tabledap/pmelTaoDySst.htmlTable?longitude,latitude,time,station,wmo_platform_code,T_25&time>=2015-05-23T12:00:00Z&time<=2015-05-31T12:00:00Z
Thus, the query is often a comma-separated list of desired variable names,
followed by a collection of
constraints (e.g., variable<value),
each preceded by '&' (which is interpreted as "AND").
For details, see the tabledap Documentation.