|
BCO-DMO ERDDAP
Accessing BCO-DMO data |
log in
Brought to you by BCO-DMO |
| Dataset Title: | [MVCO environmental measurements and high throughput sequencing] - Environmental measurements and high throughput sequencing data from samples collected at Martha's Vineyard Coastal Observation (MVCO) from 2013- 2017 (Dynamics of Protistan Grazers: Diversity, Abundance and Prey Relations)
|
| Institution: | BCO-DMO (Dataset ID: bcodmo_dataset_814424) |
| Information: | Summary
| License
| Metadata
| Background
| Files
| Make a graph
|
Attributes {
s {
Start_Date {
String bcodmo_name "date";
String description "Date sampled; format: yyyy-mm-dd";
String long_name "Start Date";
String nerc_identifier "https://vocab.nerc.ac.uk/collection/P01/current/ADATAA01/";
String source_name "Start_Date";
String time_precision "1970-01-01";
String units "unitless";
}
Event_Number {
String bcodmo_name "event";
String description "MVCO event number";
String long_name "Event Number";
String nerc_identifier "https://vocab.nerc.ac.uk/collection/P01/current/EVTAGFL/";
String units "unitless";
}
Temperature {
Float64 _FillValue NaN;
Float64 actual_range -0.154585729, 21.46489198;
String bcodmo_name "temperature";
String description "water temperature";
String long_name "Temperature";
String nerc_identifier "https://vocab.nerc.ac.uk/collection/P01/current/TEMPP901/";
String units "degress Celsius";
}
Chl {
Float64 _FillValue NaN;
Float64 actual_range 0.453470189, 5.90969435;
String bcodmo_name "chl_tot";
String description "total chlorophyll";
String long_name "CHL";
String units "micrograms per liter (ug per liter)";
}
Phaeo {
Float64 _FillValue NaN;
Float64 actual_range -0.489065804, 1.642379855;
String bcodmo_name "phaeopigment";
String description "total phaeo pigment";
String long_name "Phaeo";
String nerc_identifier "https://vocab.nerc.ac.uk/collection/P01/current/PHAEFMP1/";
String units "ug per liter";
}
NO2_NO3 {
Float64 _FillValue NaN;
Float64 actual_range 0.0, 2.856747593;
String bcodmo_name "NO3_NO2";
Float64 colorBarMaximum 50.0;
Float64 colorBarMinimum 0.0;
String description "nitrate and nitrite";
String long_name "Mole Concentration Of Nitrate In Sea Water";
String units "micromolar";
}
NH4 {
Float64 _FillValue NaN;
Float64 actual_range 0.0, 3.315585523;
String bcodmo_name "Ammonium";
Float64 colorBarMaximum 5.0;
Float64 colorBarMinimum 0.0;
String description "ammonia";
String long_name "Mole Concentration Of Ammonium In Sea Water";
String nerc_identifier "https://vocab.nerc.ac.uk/collection/P01/current/AMONAAZX/";
String units "micromolar";
}
SiO2 {
Float64 _FillValue NaN;
Float64 actual_range 0.0, 15.200309295;
String bcodmo_name "Si";
String description "silicate";
String long_name "Si O2";
String units "micromolar";
}
PO43 {
Float64 _FillValue NaN;
Float64 actual_range 0.0, 0.654410322;
String bcodmo_name "PO4";
String description "phosphate";
String long_name "PO43";
String units "micromolar";
}
HPLC_Total_Chl_a {
Float32 _FillValue NaN;
Float32 actual_range 0.378, 6.431;
String bcodmo_name "chlorophyll a";
Float64 colorBarMaximum 30.0;
Float64 colorBarMinimum 0.03;
String colorBarScale "Log";
String description "HPLC determined chlorophyll a";
String long_name "Concentration Of Chlorophyll In Sea Water";
String nerc_identifier "https://vocab.nerc.ac.uk/collection/P01/current/CPHLHPP1/";
String units "ug per liter";
}
HPLC_Total_Chl_b {
Float32 _FillValue NaN;
Float32 actual_range 0.021, 0.568;
String bcodmo_name "chl_b";
String description "HPLC determined chlorophyll b";
String long_name "HPLC Total Chl B";
String nerc_identifier "https://vocab.nerc.ac.uk/collection/P01/current/CHLBHPP1/";
String units "ug per liter";
}
HPLC_Total_Chl_c {
Float32 _FillValue NaN;
Float32 actual_range 0.091, 1.433;
String bcodmo_name "chl_c";
String description "HPLC determined chlorophyll c";
String long_name "HPLC Total Chl C";
String units "ug per liter";
}
HPLC_Carotene {
Float32 _FillValue NaN;
Float32 actual_range 0.024, 0.231;
String bcodmo_name "carotene";
String description "HPLC determined carotene";
String long_name "HPLC Carotene";
String nerc_identifier "https://vocab.nerc.ac.uk/collection/P01/current/ABCRHPP1/";
String units "ug per liter";
}
HPLC_But_Fucoxanthin {
Float32 _FillValue NaN;
Float32 actual_range 0.0, 0.258;
String bcodmo_name "fucox_but";
String description "HPLC determined 19'-butanolyloxyfucoxanthin";
String long_name "HPLC But Fucoxanthin";
String units "ug per liter";
}
HPLC_Hex_Fucoxanthin {
Float32 _FillValue NaN;
Float32 actual_range 0.0, 0.32;
String bcodmo_name "fucox_hex";
String description "HPLC determined 19'-hexanoyloxyfucoxanthin";
String long_name "HPLC Hex Fucoxanthin";
String units "ug per liter";
}
HPLC_Alloxanthin {
Float32 _FillValue NaN;
Float32 actual_range 0.005, 0.3215;
String bcodmo_name "allox";
String description "HPLC determined alloxanthin";
String long_name "HPLC Alloxanthin";
String nerc_identifier "https://vocab.nerc.ac.uk/collection/P01/current/ALLOHPP1/";
String units "ug per liter";
}
HPLC_Diadinoxanthin {
Float32 _FillValue NaN;
Float32 actual_range 0.056, 0.541;
String bcodmo_name "diadinox";
String description "HPLC determined Diadinoxanthin";
String long_name "HPLC Diadinoxanthin";
String nerc_identifier "https://vocab.nerc.ac.uk/collection/P01/current/DIADHPP1/";
String units "ug per liter";
}
HPLC_Diatoxanthin {
Float32 _FillValue NaN;
Float32 actual_range 0.0045, 0.07;
String bcodmo_name "diatox";
String description "HPLC determined Diatoxanthin";
String long_name "HPLC Diatoxanthin";
String nerc_identifier "https://vocab.nerc.ac.uk/collection/P01/current/DIATHPP1/";
String units "ug per liter";
}
HPLC_Fucoxanthin {
Float32 _FillValue NaN;
Float32 actual_range 0.081, 2.912;
String bcodmo_name "fucox";
String description "HPLC determined Fucoxanthin";
String long_name "HPLC Fucoxanthin";
String nerc_identifier "https://vocab.nerc.ac.uk/collection/P01/current/FUCXHPP1/";
String units "ug per liter";
}
HPLC_Peridinin {
Float32 _FillValue NaN;
Float32 actual_range 0.0, 0.482;
String bcodmo_name "peridinin";
String description "HPLC determined Peridinin";
String long_name "HPLC Peridinin";
String nerc_identifier "https://vocab.nerc.ac.uk/collection/P01/current/PERIHPP1/";
String units "ug per liter";
}
HPLC_Zeaxanthin {
Float32 _FillValue NaN;
Float32 actual_range 0.0, 0.113;
String bcodmo_name "zeax";
String description "HPLC determined Zeaxanthin";
String long_name "HPLC Zeaxanthin";
String nerc_identifier "https://vocab.nerc.ac.uk/collection/P01/current/ZEOXHPP1/";
String units "ug per liter";
}
}
NC_GLOBAL {
String access_formats ".htmlTable,.csv,.json,.mat,.nc,.tsv";
String acquisition_description
"Surface water samples were collected at approximately 2m depth using a Niskin
bottle or a bucket near the Martha\\u2019s Vineyard Coastal Observatory (MVCO)
offshore tower (41 19.500' N, 70 34.0' W). Sampling was accomplished from
February 2013 \\u2013 August 2017 about every 1-2 months, and usually twice
monthly April \\u2013 November, for a total of 62 samples. Water was kept cool
and in the dark for transport back to the laboratory (about 1.5 hours).\\u00a0
Environmental data:
Reported temperature data are from the CTD rosette aboard the R/V Tioga.
Chlorophyll and\\u00a0phaeo were collected and analyzed in the Sosik lab at
WHOI using a Turner Designs Aquafluor Handheld 800446 extracted in 90%
acetone.
Nutrients were analyzed at WHOI's Nutrient Facility. The official protocol
summary can be found in the NES-LTER EDI data submission:
[https://portal.edirepository.org/nis/mapbrowse?packageid=knb-lter-
nes.1.2](\\\\\"https://portal.edirepository.org/nis/mapbrowse?packageid=knb-lter-
nes.1.2\\\\\")
HPLC were analyzed at Horn Point Lab, as per NASA protocol. The summary
protocol for HPLC and chl is available from Seabass:
[https://seabass.gsfc.nasa.gov/archive/WHOI/MVCO/documents](\\\\\"https://seabass.gsfc.nasa.gov/archive/WHOI/MVCO/documents\\\\\")
Sequencing data:
Volumes of water ranging from 0.75 to 2.5L were filtered in duplicate onto
45mm 0.22 \\u00b5m Durapore GV filters under gentle vacuum. Filters were cut in
half, placed into sterile 1.5 ml microfuge tubes, and stored at -80C until
extraction.
Nucleic acids were extracted using the Zymo Research Fungal/Bacterial DNA
MicroPrep Kit (Zymo Research Products). One half filter for each sample was
transferred to a 2 ml microcentrifuge tube with silica beads and lysis buffer,
and then shaken using a vortex adapter for 5 minutes. The extraction was then
processed following the kit instructions and the eluted DNA frozen at -20C.
The eukaryotic ribosomal RNA gene V4 region was targeted for amplification and
sequencing using 574V4F (5'
[TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG]CGGTAAYTCCAGCTCYV) and 1132V4R (5'
[GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG]CCGTCAATTHCTTYAART), described in Hugerth
et al. (2014) and modified to include 5' adapter sequences for Illumina MiSeq
(in square brackets). PCR reactions were accomplished in triplicate for each
sample using 1 \\u00b5l template DNA, 1.25 units AmpliTaq GoldR 360 DNA
polymerase, 2mM MgCl2, 2 \\u00b5l 2.5 \\u00b5M dNTPs, and 2.5 \\u00b5l 10X
reaction buffer (25 \\u00b5l total volume) with the conditions: 95C for 8
minutes; 40 cycles of 95C for 30 seconds, 58C for 30 seconds, 72C for 90
seconds; 72C for 5 minutes; 4C hold. No template negative controls were
included with every set of PCRs. Each sample reaction was examined to confirm
the correct product size of approximately 500 bp. Triplicate reactions were
pooled and purified using either DNA Clean and Concentrator \\u2013 5 kit (Zymo
Research) or AMPure XP beads. The samples were sent to the University of Rhode
Island Genomics and Sequencing Center for library preparation and Illumina
MiSeq (250 bp paired end; 500 cycle kit V2) sequencing. Samples 1-27 and 28-62
were sequenced in separate runs about a year apart.
Ciliate-specific amplicons were generated by amplifying the region between
152-528 bp of the 18S ribosomal RNA gene. The primers used for amplification
are from Doherty et al 2007 (Aquatic Microbial Ecology). Primers were modified
to carry 5' adapter sequences as noted above. AmpliTaq Gold 360 was used for
amplification, and triplicate reactions were accomplished for each sample.
Replicates were combined and purified using Agencourt AMPure XP. Products were
sent to URI Genomics and Sequencing Center for Illumina MiSeq.
V4 amplicon raw reads are available at NCBI SRA project PRJNA504617. Ciliate
amplicon raw reads are available at NCBI SRA project PRJNA626352. The Imaging
FlowCytobot Dashboard for shared access to image data and data products,
including MVCO time series, is available at [https://ifcb-
data.whoi.edu/mvco](\\\\\"https://ifcb-data.whoi.edu/mvco\\\\\") and the WHOI dock
time series is available at [https://ifcb-data.whoi.edu/WHOI_dock](\\\\\"https
://ifcb-data.whoi.edu/WHOI_dock\\\\\").";
String awards_0_award_nid "564652";
String awards_0_award_number "OCE-1434440";
String awards_0_data_url "http://www.nsf.gov/awardsearch/showAward.do?AwardNumber=1434440";
String awards_0_funder_name "NSF Division of Ocean Sciences";
String awards_0_funding_acronym "NSF OCE";
String awards_0_funding_source_nid "355";
String awards_0_program_manager "David L. Garrison";
String awards_0_program_manager_nid "50534";
String cdm_data_type "Other";
String comment
"Environmental measurements from MVCO
PI: Rebecca Gast (WHOI)
Version date: 05 June 2020";
String Conventions "COARDS, CF-1.6, ACDD-1.3";
String creator_email "info@bco-dmo.org";
String creator_name "BCO-DMO";
String creator_type "institution";
String creator_url "https://www.bco-dmo.org/";
String data_source "extract_data_as_tsv version 2.3 19 Dec 2019";
String dataset_current_state "Final and no updates";
String date_created "2020-06-05T15:46:43Z";
String date_modified "2020-06-08T19:13:44Z";
String defaultDataQuery "&time<now";
String doi "10.26008/1912/bco-dmo.814424.1";
String history
"2026-05-15T22:22:46Z (local files)
2026-05-15T22:22:46Z https://erddap.bco-dmo.org/erddap/tabledap/bcodmo_dataset_814424.html";
String infoUrl "https://www.bco-dmo.org/dataset/814424";
String institution "BCO-DMO";
String instruments_0_acronym "Niskin bottle";
String instruments_0_dataset_instrument_nid "814431";
String instruments_0_description "A Niskin bottle (a next generation water sampler based on the Nansen bottle) is a cylindrical, non-metallic water collection device with stoppers at both ends. The bottles can be attached individually on a hydrowire or deployed in 12, 24, or 36 bottle Rosette systems mounted on a frame and combined with a CTD. Niskin bottles are used to collect discrete water samples for a range of measurements including pigments, nutrients, plankton, etc.";
String instruments_0_instrument_external_identifier "https://vocab.nerc.ac.uk/collection/L22/current/TOOL0412/";
String instruments_0_instrument_name "Niskin bottle";
String instruments_0_instrument_nid "413";
String instruments_1_acronym "CTD Sea-Bird";
String instruments_1_dataset_instrument_nid "814464";
String instruments_1_description "Conductivity, Temperature, Depth (CTD) sensor package from SeaBird Electronics, no specific unit identified. This instrument designation is used when specific make and model are not known. See also other SeaBird instruments listed under CTD. More information from Sea-Bird Electronics.";
String instruments_1_instrument_external_identifier "https://vocab.nerc.ac.uk/collection/L05/current/130/";
String instruments_1_instrument_name "CTD Sea-Bird";
String instruments_1_instrument_nid "447";
String instruments_1_supplied_name "CTD";
String instruments_2_acronym "Fluorometer";
String instruments_2_dataset_instrument_nid "814465";
String instruments_2_description "A fluorometer or fluorimeter is a device used to measure parameters of fluorescence: its intensity and wavelength distribution of emission spectrum after excitation by a certain spectrum of light. The instrument is designed to measure the amount of stimulated electromagnetic radiation produced by pulses of electromagnetic radiation emitted into a water sample or in situ.";
String instruments_2_instrument_external_identifier "https://vocab.nerc.ac.uk/collection/L05/current/113/";
String instruments_2_instrument_name "Fluorometer";
String instruments_2_instrument_nid "484";
String instruments_2_supplied_name "Turner Designs Aquafluor Handheld 800446";
String instruments_3_acronym "bucket";
String instruments_3_dataset_instrument_nid "814432";
String instruments_3_description "A bucket used to collect surface sea water samples.";
String instruments_3_instrument_external_identifier "https://vocab.nerc.ac.uk/collection/L22/current/TOOL0536/";
String instruments_3_instrument_name "bucket";
String instruments_3_instrument_nid "569";
String instruments_3_supplied_name "bucket";
String instruments_4_acronym "Thermal Cycler";
String instruments_4_dataset_instrument_nid "814433";
String instruments_4_description
"General term for a laboratory apparatus commonly used for performing polymerase chain reaction (PCR). The device has a thermal block with holes where tubes with the PCR reaction mixtures can be inserted. The cycler then raises and lowers the temperature of the block in discrete, pre-programmed steps.
(adapted from http://serc.carleton.edu/microbelife/research_methods/genomics/pcr.html)";
String instruments_4_instrument_name "PCR Thermal Cycler";
String instruments_4_instrument_nid "471582";
String keywords "alloxanthin, ammonia, ammonium, bco, bco-dmo, biological, but, carotene, chemical, chemistry, chl, chlorophyll, concentration, concentration_of_chlorophyll_in_sea_water, data, dataset, date, diadinoxanthin, diatoxanthin, dmo, earth, Earth Science > Oceans > Ocean Chemistry > Ammonia, Earth Science > Oceans > Ocean Chemistry > Chlorophyll, Earth Science > Oceans > Ocean Chemistry > Nitrate, erddap, event, Event_Number, fucoxanthin, hex, hplc, HPLC_Alloxanthin, HPLC_But_Fucoxanthin, HPLC_Carotene, HPLC_Diadinoxanthin, HPLC_Diatoxanthin, HPLC_Fucoxanthin, HPLC_Hex_Fucoxanthin, HPLC_Peridinin, HPLC_Total_Chl_a, HPLC_Total_Chl_b, HPLC_Total_Chl_c, HPLC_Zeaxanthin, management, mole, mole_concentration_of_ammonium_in_sea_water, mole_concentration_of_nitrate_in_sea_water, n02, nh4, nitrate, NO2_NO3, no3, number, O2, ocean, oceanography, oceans, office, oxygen, peridinin, phaeo, po43, preliminary, science, sea, seawater, SiO2, start, temperature, time, total, water, zeaxanthin";
String keywords_vocabulary "GCMD Science Keywords";
String license "https://www.bco-dmo.org/dataset/814424/license";
String metadata_source "https://www.bco-dmo.org/api/dataset/814424";
String param_mapping "{'814424': {}}";
String parameter_source "https://www.bco-dmo.org/mapserver/dataset/814424/parameters";
String people_0_affiliation "Woods Hole Oceanographic Institution";
String people_0_affiliation_acronym "WHOI";
String people_0_person_name "Rebecca J. Gast";
String people_0_person_nid "51278";
String people_0_role "Principal Investigator";
String people_0_role_type "originator";
String people_1_affiliation "Woods Hole Oceanographic Institution";
String people_1_affiliation_acronym "WHOI";
String people_1_person_name "Taylor Crockford";
String people_1_person_nid "814428";
String people_1_role "Contact";
String people_1_role_type "related";
String people_2_affiliation "Woods Hole Oceanographic Institution";
String people_2_affiliation_acronym "WHOI BCO-DMO";
String people_2_person_name "Shannon Rauch";
String people_2_person_nid "51498";
String people_2_role "BCO-DMO Data Manager";
String people_2_role_type "related";
String project "Staining IFCB";
String projects_0_acronym "Staining IFCB";
String projects_0_description
"Description from NSF award abstract:
Some of the most important primary producers and consumers in aquatic ecosystems are protists, or single-celled eukaryotes. It is well established that protistan predation can be a significant source of mortality for bacteria and phytoplankton. Grazing protists in turn serve as prey for zooplankton (copepods), and through the excretion of nitrogen and phosphorus compounds, they play a major role in the release of regenerated nutrients. Despite decades of studies on protistan grazing, knowledge gaps still exist with respect to their abundance, distribution, seasonality, prey selectivity, and co-occurrence patterns. The results from this project will advance the understanding of grazing communities in situ and how they respond to environmental conditions and prey communities. This will be one of very few studies of grazers that is unbiased by artificial prey and containment, and will yield both morphologic and genetic information about the organisms present and the distribution patterns of particular grazer populations.
This project examines whether the persistence of a group of protistan grazers is determined by its feeding strategy (grazers with specialist feeding strategies are more ephemeral than generalists), and whether certain morphotypes exhibiting generalist feeding strategies have underlying genotypic diversity that maps to specialist feeding strategies. It builds upon an ongoing time series (with hourly resolution since 2006) of automated, high-resolution, measurements of the phytoplankton community by the Imaging FlowCytobot at the Martha's Vineyard Coastal Observatory. These measurements have led to the observation that, in addition to shifts from pico- and small nanoplankton during the summer to larger microplankton in the fall and winter, particular species (especially among the diatoms) exhibit distinct and recurring seasonal patterns. The instrument will be modified to also conduct automated measurements of grazer communities in situ. Links between selected grazer taxa (chosen based on the image time series) and phytoplankton prey will be provided through genetic analyses of individual cells (with their ingested prey). These cells will be obtained by use of a recently developed cell sorter that also captures an image of each sorted cell. In addition to providing predator/prey links, the genetic information will allow the investigators to determine whether a grazer morphotype represents multiple species. A third approach, high throughput sequencing and quantitative PCR analysis of whole water samples, will be applied to investigate abundance patterns of species whose morphology does not reliably map to genotype.";
String projects_0_end_date "2017-08";
String projects_0_geolocation "Martha’s Vineyard Coastal Observatory, WHOI Dock";
String projects_0_name "Dynamics of Protistan Grazers: Diversity, Abundance and Prey Relations";
String projects_0_project_nid "564653";
String projects_0_start_date "2014-09";
String publisher_name "Biological and Chemical Oceanographic Data Management Office (BCO-DMO)";
String publisher_type "institution";
String sourceUrl "(local files)";
String standard_name_vocabulary "CF Standard Name Table v55";
String summary "This dataset contains environmental measurements from Martha's Vineyard Coastal Observatory (MVCO) made from 2013-2017. Related high throughput sequencing data are available from NCBI under project numbers PRJNA504617 and PRJNA626352.";
String title "[MVCO environmental measurements and high throughput sequencing] - Environmental measurements and high throughput sequencing data from samples collected at Martha's Vineyard Coastal Observation (MVCO) from 2013-2017 (Dynamics of Protistan Grazers: Diversity, Abundance and Prey Relations)";
String version "1";
String xml_source "osprey2erddap.update_xml() v1.5";
}
}
Data Access Protocol (DAP)
and its
selection constraints
.
The URL specifies what you want: the dataset, a description of the graph or the subset of the data, and the file type for the response.
Tabledap request URLs must be in the form
https://coastwatch.pfeg.noaa.gov/erddap/tabledap/datasetID.fileType{?query}
For example,
https://coastwatch.pfeg.noaa.gov/erddap/tabledap/pmelTaoDySst.htmlTable?longitude,latitude,time,station,wmo_platform_code,T_25&time>=2015-05-23T12:00:00Z&time<=2015-05-31T12:00:00Z
Thus, the query is often a comma-separated list of desired variable names,
followed by a collection of
constraints (e.g., variable<value),
each preceded by '&' (which is interpreted as "AND").
For details, see the tabledap Documentation.