BCO-DMO ERDDAP
Accessing BCO-DMO data 		log in    
Brought to you by BCO-DMO    

ERDDAP > info > bcodmo_dataset_814424

Grid
DAP
Data 		Sub-
set 		Table
DAP
Data 		Make
A
Graph 		W
M
S 		Source
Data
Files 		Acces-
sible
? 		Title Sum-
mary 		FGDC,
ISO,
Metadata 		Back-
ground
Info 		RSS E
mail 		Institution Dataset ID
     data   graph     files  public [MVCO environmental measurements and high throughput sequencing] - Environmental measurements
and high throughput sequencing data from samples collected at Martha's Vineyard Coastal
Observation (MVCO) from 2013-2017 (Dynamics of Protistan Grazers: Diversity, Abundance and
Prey Relations) 		   ?        I   M   background (external link) RSS Subscribe BCO-DMO bcodmo_dataset_814424

The Dataset's Variables and Attributes

Row Type Variable Name Attribute Name Data Type Value
attribute NC_GLOBAL access_formats String .htmlTable,.csv,.json,.mat,.nc,.tsv
attribute NC_GLOBAL acquisition_description String Surface water samples were collected at approximately 2m depth using a Niskin
bottle or a bucket near the Martha\u2019s Vineyard Coastal Observatory (MVCO)
offshore tower (41 19.500' N, 70 34.0' W). Sampling was accomplished from
February 2013 \u2013 August 2017 about every 1-2 months, and usually twice
monthly April \u2013 November, for a total of 62 samples. Water was kept cool
and in the dark for transport back to the laboratory (about 1.5 hours).\u00a0

Environmental data:
Reported temperature data are from the CTD rosette aboard the R/V Tioga.
Chlorophyll and\u00a0phaeo were collected and analyzed in the Sosik lab at
WHOI using a Turner Designs Aquafluor Handheld 800446 extracted in 90%
acetone.

Nutrients were analyzed at WHOI's Nutrient Facility. The official protocol
summary can be found in the NES-LTER EDI data submission:
[https://portal.edirepository.org/nis/mapbrowse?packageid=knb-lter-
nes.1.2](\\"https://portal.edirepository.org/nis/mapbrowse?packageid=knb-lter-
nes.1.2\\")

HPLC were analyzed at Horn Point Lab, as per NASA protocol. The summary
protocol for HPLC and chl is available from Seabass:
[https://seabass.gsfc.nasa.gov/archive/WHOI/MVCO/documents](\\"https://seabass.gsfc.nasa.gov/archive/WHOI/MVCO/documents\\")

Sequencing data:
Volumes of water ranging from 0.75 to 2.5L were filtered in duplicate onto
45mm 0.22 \u00b5m Durapore GV filters under gentle vacuum. Filters were cut in
half, placed into sterile 1.5 ml microfuge tubes, and stored at -80C until
extraction.

Nucleic acids were extracted using the Zymo Research Fungal/Bacterial DNA
MicroPrep Kit (Zymo Research Products). One half filter for each sample was
transferred to a 2 ml microcentrifuge tube with silica beads and lysis buffer,
and then shaken using a vortex adapter for 5 minutes. The extraction was then
processed following the kit instructions and the eluted DNA frozen at -20C.

The eukaryotic ribosomal RNA gene V4 region was targeted for amplification and
sequencing using 574V4F (5'
[TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG]CGGTAAYTCCAGCTCYV) and 1132V4R (5'
[GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG]CCGTCAATTHCTTYAART), described in Hugerth
et al. (2014) and modified to include 5' adapter sequences for Illumina MiSeq
(in square brackets). PCR reactions were accomplished in triplicate for each
sample using 1 \u00b5l template DNA, 1.25 units AmpliTaq GoldR 360 DNA
polymerase, 2mM MgCl2, 2 \u00b5l 2.5 \u00b5M dNTPs, and 2.5 \u00b5l 10X
reaction buffer (25 \u00b5l total volume) with the conditions: 95C for 8
minutes; 40 cycles of 95C for 30 seconds, 58C for 30 seconds, 72C for 90
seconds; 72C for 5 minutes; 4C hold. No template negative controls were
included with every set of PCRs. Each sample reaction was examined to confirm
the correct product size of approximately 500 bp. Triplicate reactions were
pooled and purified using either DNA Clean and Concentrator \u2013 5 kit (Zymo
Research) or AMPure XP beads. The samples were sent to the University of Rhode
Island Genomics and Sequencing Center for library preparation and Illumina
MiSeq (250 bp paired end; 500 cycle kit V2) sequencing. Samples 1-27 and 28-62
were sequenced in separate runs about a year apart.

Ciliate-specific amplicons were generated by amplifying the region between
152-528 bp of the 18S ribosomal RNA gene. The primers used for amplification
are from Doherty et al 2007 (Aquatic Microbial Ecology). Primers were modified
to carry 5' adapter sequences as noted above. AmpliTaq Gold 360 was used for
amplification, and triplicate reactions were accomplished for each sample.
Replicates were combined and purified using Agencourt AMPure XP. Products were
sent to URI Genomics and Sequencing Center for Illumina MiSeq.

V4 amplicon raw reads are available at NCBI SRA project PRJNA504617. Ciliate
amplicon raw reads are available at NCBI SRA project PRJNA626352. The Imaging
FlowCytobot Dashboard for shared access to image data and data products,
including MVCO time series, is available at [https://ifcb-
data.whoi.edu/mvco](\\"https://ifcb-data.whoi.edu/mvco\\") and the WHOI dock
time series is available at [https://ifcb-data.whoi.edu/WHOI_dock](\\"https
://ifcb-data.whoi.edu/WHOI_dock\\").
attribute NC_GLOBAL awards_0_award_nid String 564652
attribute NC_GLOBAL awards_0_award_number String OCE-1434440
attribute NC_GLOBAL awards_0_data_url String http://www.nsf.gov/awardsearch/showAward.do?AwardNumber=1434440 (external link)
attribute NC_GLOBAL awards_0_funder_name String NSF Division of Ocean Sciences
attribute NC_GLOBAL awards_0_funding_acronym String NSF OCE
attribute NC_GLOBAL awards_0_funding_source_nid String 355
attribute NC_GLOBAL awards_0_program_manager String David L. Garrison
attribute NC_GLOBAL awards_0_program_manager_nid String 50534
attribute NC_GLOBAL cdm_data_type String Other
attribute NC_GLOBAL comment String Environmental measurements from MVCO
PI: Rebecca Gast (WHOI)
Version date: 05 June 2020
attribute NC_GLOBAL Conventions String COARDS, CF-1.6, ACDD-1.3
attribute NC_GLOBAL creator_email String info at bco-dmo.org
attribute NC_GLOBAL creator_name String BCO-DMO
attribute NC_GLOBAL creator_type String institution
attribute NC_GLOBAL creator_url String https://www.bco-dmo.org/ (external link)
attribute NC_GLOBAL data_source String extract_data_as_tsv version 2.3 19 Dec 2019
attribute NC_GLOBAL dataset_current_state String Final and no updates
attribute NC_GLOBAL date_created String 2020-06-05T15:46:43Z
attribute NC_GLOBAL date_modified String 2020-06-08T19:13:44Z
attribute NC_GLOBAL defaultDataQuery String &time<now
attribute NC_GLOBAL doi String 10.26008/1912/bco-dmo.814424.1
attribute NC_GLOBAL infoUrl String https://www.bco-dmo.org/dataset/814424 (external link)
attribute NC_GLOBAL institution String BCO-DMO
attribute NC_GLOBAL instruments_0_acronym String Niskin bottle
attribute NC_GLOBAL instruments_0_dataset_instrument_nid String 814431
attribute NC_GLOBAL instruments_0_description String A Niskin bottle (a next generation water sampler based on the Nansen bottle) is a cylindrical, non-metallic water collection device with stoppers at both ends. The bottles can be attached individually on a hydrowire or deployed in 12, 24, or 36 bottle Rosette systems mounted on a frame and combined with a CTD. Niskin bottles are used to collect discrete water samples for a range of measurements including pigments, nutrients, plankton, etc.
attribute NC_GLOBAL instruments_0_instrument_external_identifier String https://vocab.nerc.ac.uk/collection/L22/current/TOOL0412/ (external link)
attribute NC_GLOBAL instruments_0_instrument_name String Niskin bottle
attribute NC_GLOBAL instruments_0_instrument_nid String 413
attribute NC_GLOBAL instruments_1_acronym String CTD Sea-Bird
attribute NC_GLOBAL instruments_1_dataset_instrument_nid String 814464
attribute NC_GLOBAL instruments_1_description String Conductivity, Temperature, Depth (CTD) sensor package from SeaBird Electronics, no specific unit identified. This instrument designation is used when specific make and model are not known. See also other SeaBird instruments listed under CTD. More information from Sea-Bird Electronics.
attribute NC_GLOBAL instruments_1_instrument_external_identifier String https://vocab.nerc.ac.uk/collection/L05/current/130/ (external link)
attribute NC_GLOBAL instruments_1_instrument_name String CTD Sea-Bird
attribute NC_GLOBAL instruments_1_instrument_nid String 447
attribute NC_GLOBAL instruments_1_supplied_name String CTD
attribute NC_GLOBAL instruments_2_acronym String Fluorometer
attribute NC_GLOBAL instruments_2_dataset_instrument_nid String 814465
attribute NC_GLOBAL instruments_2_description String A fluorometer or fluorimeter is a device used to measure parameters of fluorescence: its intensity and wavelength distribution of emission spectrum after excitation by a certain spectrum of light. The instrument is designed to measure the amount of stimulated electromagnetic radiation produced by pulses of electromagnetic radiation emitted into a water sample or in situ.
attribute NC_GLOBAL instruments_2_instrument_external_identifier String https://vocab.nerc.ac.uk/collection/L05/current/113/ (external link)
attribute NC_GLOBAL instruments_2_instrument_name String Fluorometer
attribute NC_GLOBAL instruments_2_instrument_nid String 484
attribute NC_GLOBAL instruments_2_supplied_name String Turner Designs Aquafluor Handheld 800446
attribute NC_GLOBAL instruments_3_acronym String bucket
attribute NC_GLOBAL instruments_3_dataset_instrument_nid String 814432
attribute NC_GLOBAL instruments_3_description String A bucket used to collect surface sea water samples.
attribute NC_GLOBAL instruments_3_instrument_external_identifier String https://vocab.nerc.ac.uk/collection/L22/current/TOOL0536/ (external link)
attribute NC_GLOBAL instruments_3_instrument_name String bucket
attribute NC_GLOBAL instruments_3_instrument_nid String 569
attribute NC_GLOBAL instruments_3_supplied_name String bucket
attribute NC_GLOBAL instruments_4_acronym String Thermal Cycler
attribute NC_GLOBAL instruments_4_dataset_instrument_nid String 814433
attribute NC_GLOBAL instruments_4_description String General term for a laboratory apparatus commonly used for performing polymerase chain reaction (PCR). The device has a thermal block with holes where tubes with the PCR reaction mixtures can be inserted. The cycler then raises and lowers the temperature of the block in discrete, pre-programmed steps.

(adapted from http://serc.carleton.edu/microbelife/research_methods/genomics/pcr.html)
attribute NC_GLOBAL instruments_4_instrument_name String PCR Thermal Cycler
attribute NC_GLOBAL instruments_4_instrument_nid String 471582
attribute NC_GLOBAL keywords String alloxanthin, ammonia, ammonium, bco, bco-dmo, biological, but, carotene, chemical, chemistry, chl, chlorophyll, concentration, concentration_of_chlorophyll_in_sea_water, data, dataset, date, diadinoxanthin, diatoxanthin, dmo, earth, Earth Science > Oceans > Ocean Chemistry > Ammonia, Earth Science > Oceans > Ocean Chemistry > Chlorophyll, Earth Science > Oceans > Ocean Chemistry > Nitrate, erddap, event, Event_Number, fucoxanthin, hex, hplc, HPLC_Alloxanthin, HPLC_But_Fucoxanthin, HPLC_Carotene, HPLC_Diadinoxanthin, HPLC_Diatoxanthin, HPLC_Fucoxanthin, HPLC_Hex_Fucoxanthin, HPLC_Peridinin, HPLC_Total_Chl_a, HPLC_Total_Chl_b, HPLC_Total_Chl_c, HPLC_Zeaxanthin, management, mole, mole_concentration_of_ammonium_in_sea_water, mole_concentration_of_nitrate_in_sea_water, n02, nh4, nitrate, NO2_NO3, no3, number, O2, ocean, oceanography, oceans, office, oxygen, peridinin, phaeo, po43, preliminary, science, sea, seawater, SiO2, start, temperature, time, total, water, zeaxanthin
attribute NC_GLOBAL keywords_vocabulary String GCMD Science Keywords
attribute NC_GLOBAL license String https://www.bco-dmo.org/dataset/814424/license (external link)
attribute NC_GLOBAL metadata_source String https://www.bco-dmo.org/api/dataset/814424 (external link)
attribute NC_GLOBAL param_mapping String {'814424': {}}
attribute NC_GLOBAL parameter_source String https://www.bco-dmo.org/mapserver/dataset/814424/parameters (external link)
attribute NC_GLOBAL people_0_affiliation String Woods Hole Oceanographic Institution
attribute NC_GLOBAL people_0_affiliation_acronym String WHOI
attribute NC_GLOBAL people_0_person_name String Rebecca J. Gast
attribute NC_GLOBAL people_0_person_nid String 51278
attribute NC_GLOBAL people_0_role String Principal Investigator
attribute NC_GLOBAL people_0_role_type String originator
attribute NC_GLOBAL people_1_affiliation String Woods Hole Oceanographic Institution
attribute NC_GLOBAL people_1_affiliation_acronym String WHOI
attribute NC_GLOBAL people_1_person_name String Taylor Crockford
attribute NC_GLOBAL people_1_person_nid String 814428
attribute NC_GLOBAL people_1_role String Contact
attribute NC_GLOBAL people_1_role_type String related
attribute NC_GLOBAL people_2_affiliation String Woods Hole Oceanographic Institution
attribute NC_GLOBAL people_2_affiliation_acronym String WHOI BCO-DMO
attribute NC_GLOBAL people_2_person_name String Shannon Rauch
attribute NC_GLOBAL people_2_person_nid String 51498
attribute NC_GLOBAL people_2_role String BCO-DMO Data Manager
attribute NC_GLOBAL people_2_role_type String related
attribute NC_GLOBAL project String Staining IFCB
attribute NC_GLOBAL projects_0_acronym String Staining IFCB
attribute NC_GLOBAL projects_0_description String Description from NSF award abstract:
Some of the most important primary producers and consumers in aquatic ecosystems are protists, or single-celled eukaryotes. It is well established that protistan predation can be a significant source of mortality for bacteria and phytoplankton. Grazing protists in turn serve as prey for zooplankton (copepods), and through the excretion of nitrogen and phosphorus compounds, they play a major role in the release of regenerated nutrients. Despite decades of studies on protistan grazing, knowledge gaps still exist with respect to their abundance, distribution, seasonality, prey selectivity, and co-occurrence patterns. The results from this project will advance the understanding of grazing communities in situ and how they respond to environmental conditions and prey communities. This will be one of very few studies of grazers that is unbiased by artificial prey and containment, and will yield both morphologic and genetic information about the organisms present and the distribution patterns of particular grazer populations.
This project examines whether the persistence of a group of protistan grazers is determined by its feeding strategy (grazers with specialist feeding strategies are more ephemeral than generalists), and whether certain morphotypes exhibiting generalist feeding strategies have underlying genotypic diversity that maps to specialist feeding strategies. It builds upon an ongoing time series (with hourly resolution since 2006) of automated, high-resolution, measurements of the phytoplankton community by the Imaging FlowCytobot at the Martha's Vineyard Coastal Observatory. These measurements have led to the observation that, in addition to shifts from pico- and small nanoplankton during the summer to larger microplankton in the fall and winter, particular species (especially among the diatoms) exhibit distinct and recurring seasonal patterns. The instrument will be modified to also conduct automated measurements of grazer communities in situ. Links between selected grazer taxa (chosen based on the image time series) and phytoplankton prey will be provided through genetic analyses of individual cells (with their ingested prey). These cells will be obtained by use of a recently developed cell sorter that also captures an image of each sorted cell. In addition to providing predator/prey links, the genetic information will allow the investigators to determine whether a grazer morphotype represents multiple species. A third approach, high throughput sequencing and quantitative PCR analysis of whole water samples, will be applied to investigate abundance patterns of species whose morphology does not reliably map to genotype.
attribute NC_GLOBAL projects_0_end_date String 2017-08
attribute NC_GLOBAL projects_0_geolocation String Martha’s Vineyard Coastal Observatory, WHOI Dock
attribute NC_GLOBAL projects_0_name String Dynamics of Protistan Grazers: Diversity, Abundance and Prey Relations
attribute NC_GLOBAL projects_0_project_nid String 564653
attribute NC_GLOBAL projects_0_start_date String 2014-09
attribute NC_GLOBAL publisher_name String Biological and Chemical Oceanographic Data Management Office (BCO-DMO)
attribute NC_GLOBAL publisher_type String institution
attribute NC_GLOBAL sourceUrl String (local files)
attribute NC_GLOBAL standard_name_vocabulary String CF Standard Name Table v55
attribute NC_GLOBAL summary String This dataset contains environmental measurements from Martha's Vineyard Coastal Observatory (MVCO) made from 2013-2017. Related high throughput sequencing data are available from NCBI under project numbers PRJNA504617 and PRJNA626352.
attribute NC_GLOBAL title String [MVCO environmental measurements and high throughput sequencing] - Environmental measurements and high throughput sequencing data from samples collected at Martha's Vineyard Coastal Observation (MVCO) from 2013-2017 (Dynamics of Protistan Grazers: Diversity, Abundance and Prey Relations)
attribute NC_GLOBAL version String 1
attribute NC_GLOBAL xml_source String osprey2erddap.update_xml() v1.5
variable Start_Date   String  
attribute Start_Date bcodmo_name String date
attribute Start_Date description String Date sampled; format: yyyy-mm-dd
attribute Start_Date long_name String Start Date
attribute Start_Date nerc_identifier String https://vocab.nerc.ac.uk/collection/P01/current/ADATAA01/ (external link)
attribute Start_Date source_name String Start_Date
attribute Start_Date time_precision String 1970-01-01
attribute Start_Date units String unitless
variable Event_Number   String  
attribute Event_Number bcodmo_name String event
attribute Event_Number description String MVCO event number
attribute Event_Number long_name String Event Number
attribute Event_Number nerc_identifier String https://vocab.nerc.ac.uk/collection/P01/current/EVTAGFL/ (external link)
attribute Event_Number units String unitless
variable Temperature   double  
attribute Temperature _FillValue double NaN
attribute Temperature actual_range double -0.154585729, 21.46489198
attribute Temperature bcodmo_name String temperature
attribute Temperature description String water temperature
attribute Temperature long_name String Temperature
attribute Temperature nerc_identifier String https://vocab.nerc.ac.uk/collection/P01/current/TEMPP901/ (external link)
attribute Temperature units String degress Celsius
variable Chl   double  
attribute Chl _FillValue double NaN
attribute Chl actual_range double 0.453470189, 5.90969435
attribute Chl bcodmo_name String chl_tot
attribute Chl description String total chlorophyll
attribute Chl long_name String CHL
attribute Chl units String micrograms per liter (ug per liter)
variable Phaeo   double  
attribute Phaeo _FillValue double NaN
attribute Phaeo actual_range double -0.489065804, 1.642379855
attribute Phaeo bcodmo_name String phaeopigment
attribute Phaeo description String total phaeo pigment
attribute Phaeo long_name String Phaeo
attribute Phaeo nerc_identifier String https://vocab.nerc.ac.uk/collection/P01/current/PHAEFMP1/ (external link)
attribute Phaeo units String ug per liter
variable NO2_NO3   double  
attribute NO2_NO3 _FillValue double NaN
attribute NO2_NO3 actual_range double 0.0, 2.856747593
attribute NO2_NO3 bcodmo_name String NO3_NO2
attribute NO2_NO3 colorBarMaximum double 50.0
attribute NO2_NO3 colorBarMinimum double 0.0
attribute NO2_NO3 description String nitrate and nitrite
attribute NO2_NO3 long_name String Mole Concentration Of Nitrate In Sea Water
attribute NO2_NO3 units String micromolar
variable NH4   double  
attribute NH4 _FillValue double NaN
attribute NH4 actual_range double 0.0, 3.315585523
attribute NH4 bcodmo_name String Ammonium
attribute NH4 colorBarMaximum double 5.0
attribute NH4 colorBarMinimum double 0.0
attribute NH4 description String ammonia
attribute NH4 long_name String Mole Concentration Of Ammonium In Sea Water
attribute NH4 nerc_identifier String https://vocab.nerc.ac.uk/collection/P01/current/AMONAAZX/ (external link)
attribute NH4 units String micromolar
variable SiO2   double  
attribute SiO2 _FillValue double NaN
attribute SiO2 actual_range double 0.0, 15.200309295
attribute SiO2 bcodmo_name String Si
attribute SiO2 description String silicate
attribute SiO2 long_name String Si O2
attribute SiO2 units String micromolar
variable PO43   double  
attribute PO43 _FillValue double NaN
attribute PO43 actual_range double 0.0, 0.654410322
attribute PO43 bcodmo_name String PO4
attribute PO43 description String phosphate
attribute PO43 long_name String PO43
attribute PO43 units String micromolar
variable HPLC_Total_Chl_a   float  
attribute HPLC_Total_Chl_a _FillValue float NaN
attribute HPLC_Total_Chl_a actual_range float 0.378, 6.431
attribute HPLC_Total_Chl_a bcodmo_name String chlorophyll a
attribute HPLC_Total_Chl_a colorBarMaximum double 30.0
attribute HPLC_Total_Chl_a colorBarMinimum double 0.03
attribute HPLC_Total_Chl_a colorBarScale String Log
attribute HPLC_Total_Chl_a description String HPLC determined chlorophyll a
attribute HPLC_Total_Chl_a long_name String Concentration Of Chlorophyll In Sea Water
attribute HPLC_Total_Chl_a nerc_identifier String https://vocab.nerc.ac.uk/collection/P01/current/CPHLHPP1/ (external link)
attribute HPLC_Total_Chl_a units String ug per liter
variable HPLC_Total_Chl_b   float  
attribute HPLC_Total_Chl_b _FillValue float NaN
attribute HPLC_Total_Chl_b actual_range float 0.021, 0.568
attribute HPLC_Total_Chl_b bcodmo_name String chl_b
attribute HPLC_Total_Chl_b description String HPLC determined chlorophyll b
attribute HPLC_Total_Chl_b long_name String HPLC Total Chl B
attribute HPLC_Total_Chl_b nerc_identifier String https://vocab.nerc.ac.uk/collection/P01/current/CHLBHPP1/ (external link)
attribute HPLC_Total_Chl_b units String ug per liter
variable HPLC_Total_Chl_c   float  
attribute HPLC_Total_Chl_c _FillValue float NaN
attribute HPLC_Total_Chl_c actual_range float 0.091, 1.433
attribute HPLC_Total_Chl_c bcodmo_name String chl_c
attribute HPLC_Total_Chl_c description String HPLC determined chlorophyll c
attribute HPLC_Total_Chl_c long_name String HPLC Total Chl C
attribute HPLC_Total_Chl_c units String ug per liter
variable HPLC_Carotene   float  
attribute HPLC_Carotene _FillValue float NaN
attribute HPLC_Carotene actual_range float 0.024, 0.231
attribute HPLC_Carotene bcodmo_name String carotene
attribute HPLC_Carotene description String HPLC determined carotene
attribute HPLC_Carotene long_name String HPLC Carotene
attribute HPLC_Carotene nerc_identifier String https://vocab.nerc.ac.uk/collection/P01/current/ABCRHPP1/ (external link)
attribute HPLC_Carotene units String ug per liter
variable HPLC_But_Fucoxanthin   float  
attribute HPLC_But_Fucoxanthin _FillValue float NaN
attribute HPLC_But_Fucoxanthin actual_range float 0.0, 0.258
attribute HPLC_But_Fucoxanthin bcodmo_name String fucox_but
attribute HPLC_But_Fucoxanthin description String HPLC determined 19'-butanolyloxyfucoxanthin
attribute HPLC_But_Fucoxanthin long_name String HPLC But Fucoxanthin
attribute HPLC_But_Fucoxanthin units String ug per liter
variable HPLC_Hex_Fucoxanthin   float  
attribute HPLC_Hex_Fucoxanthin _FillValue float NaN
attribute HPLC_Hex_Fucoxanthin actual_range float 0.0, 0.32
attribute HPLC_Hex_Fucoxanthin bcodmo_name String fucox_hex
attribute HPLC_Hex_Fucoxanthin description String HPLC determined 19'-hexanoyloxyfucoxanthin
attribute HPLC_Hex_Fucoxanthin long_name String HPLC Hex Fucoxanthin
attribute HPLC_Hex_Fucoxanthin units String ug per liter
variable HPLC_Alloxanthin   float  
attribute HPLC_Alloxanthin _FillValue float NaN
attribute HPLC_Alloxanthin actual_range float 0.005, 0.3215
attribute HPLC_Alloxanthin bcodmo_name String allox
attribute HPLC_Alloxanthin description String HPLC determined alloxanthin
attribute HPLC_Alloxanthin long_name String HPLC Alloxanthin
attribute HPLC_Alloxanthin nerc_identifier String https://vocab.nerc.ac.uk/collection/P01/current/ALLOHPP1/ (external link)
attribute HPLC_Alloxanthin units String ug per liter
variable HPLC_Diadinoxanthin   float  
attribute HPLC_Diadinoxanthin _FillValue float NaN
attribute HPLC_Diadinoxanthin actual_range float 0.056, 0.541
attribute HPLC_Diadinoxanthin bcodmo_name String diadinox
attribute HPLC_Diadinoxanthin description String HPLC determined Diadinoxanthin
attribute HPLC_Diadinoxanthin long_name String HPLC Diadinoxanthin
attribute HPLC_Diadinoxanthin nerc_identifier String https://vocab.nerc.ac.uk/collection/P01/current/DIADHPP1/ (external link)
attribute HPLC_Diadinoxanthin units String ug per liter
variable HPLC_Diatoxanthin   float  
attribute HPLC_Diatoxanthin _FillValue float NaN
attribute HPLC_Diatoxanthin actual_range float 0.0045, 0.07
attribute HPLC_Diatoxanthin bcodmo_name String diatox
attribute HPLC_Diatoxanthin description String HPLC determined Diatoxanthin
attribute HPLC_Diatoxanthin long_name String HPLC Diatoxanthin
attribute HPLC_Diatoxanthin nerc_identifier String https://vocab.nerc.ac.uk/collection/P01/current/DIATHPP1/ (external link)
attribute HPLC_Diatoxanthin units String ug per liter
variable HPLC_Fucoxanthin   float  
attribute HPLC_Fucoxanthin _FillValue float NaN
attribute HPLC_Fucoxanthin actual_range float 0.081, 2.912
attribute HPLC_Fucoxanthin bcodmo_name String fucox
attribute HPLC_Fucoxanthin description String HPLC determined Fucoxanthin
attribute HPLC_Fucoxanthin long_name String HPLC Fucoxanthin
attribute HPLC_Fucoxanthin nerc_identifier String https://vocab.nerc.ac.uk/collection/P01/current/FUCXHPP1/ (external link)
attribute HPLC_Fucoxanthin units String ug per liter
variable HPLC_Peridinin   float  
attribute HPLC_Peridinin _FillValue float NaN
attribute HPLC_Peridinin actual_range float 0.0, 0.482
attribute HPLC_Peridinin bcodmo_name String peridinin
attribute HPLC_Peridinin description String HPLC determined Peridinin
attribute HPLC_Peridinin long_name String HPLC Peridinin
attribute HPLC_Peridinin nerc_identifier String https://vocab.nerc.ac.uk/collection/P01/current/PERIHPP1/ (external link)
attribute HPLC_Peridinin units String ug per liter
variable HPLC_Zeaxanthin   float  
attribute HPLC_Zeaxanthin _FillValue float NaN
attribute HPLC_Zeaxanthin actual_range float 0.0, 0.113
attribute HPLC_Zeaxanthin bcodmo_name String zeax
attribute HPLC_Zeaxanthin description String HPLC determined Zeaxanthin
attribute HPLC_Zeaxanthin long_name String HPLC Zeaxanthin
attribute HPLC_Zeaxanthin nerc_identifier String https://vocab.nerc.ac.uk/collection/P01/current/ZEOXHPP1/ (external link)
attribute HPLC_Zeaxanthin units String ug per liter

The information in the table above is also available in other file formats (.csv, .htmlTable, .itx, .json, .jsonlCSV1, .jsonlCSV, .jsonlKVP, .mat, .nc, .nccsv, .tsv, .xhtml) via a RESTful web service.


 
ERDDAP, Version 2.22
Disclaimers | Privacy Policy | Contact