![]() |
BCO-DMO ERDDAP
Accessing BCO-DMO data |
log in
Brought to you by BCO-DMO |
Grid DAP Data | Sub- set | Table DAP Data | Make A Graph | W M S | Source Data Files | Acces- sible ![]() | Title | Sum- mary | FGDC, ISO, Metadata | Back- ground Info | RSS | E | Institution | Dataset ID |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
data | graph | files | public | [MVCO environmental measurements and high throughput sequencing] - Environmental measurements and high throughput sequencing data from samples collected at Martha's Vineyard Coastal Observation (MVCO) from 2013-2017 (Dynamics of Protistan Grazers: Diversity, Abundance and Prey Relations) | ![]() | M | background![]() | ![]() | ![]() | BCO-DMO | bcodmo_dataset_814424 |
Row Type | Variable Name | Attribute Name | Data Type | Value |
---|---|---|---|---|
attribute | NC_GLOBAL | access_formats | String | .htmlTable,.csv,.json,.mat,.nc,.tsv |
attribute | NC_GLOBAL | acquisition_description | String | Surface water samples were collected at approximately 2m depth using a Niskin bottle or a bucket near the Martha\u2019s Vineyard Coastal Observatory (MVCO) offshore tower (41 19.500' N, 70 34.0' W). Sampling was accomplished from February 2013 \u2013 August 2017 about every 1-2 months, and usually twice monthly April \u2013 November, for a total of 62 samples. Water was kept cool and in the dark for transport back to the laboratory (about 1.5 hours).\u00a0 Environmental data: Reported temperature data are from the CTD rosette aboard the R/V Tioga. Chlorophyll and\u00a0phaeo were collected and analyzed in the Sosik lab at WHOI using a Turner Designs Aquafluor Handheld 800446 extracted in 90% acetone. Nutrients were analyzed at WHOI's Nutrient Facility. The official protocol summary can be found in the NES-LTER EDI data submission: [https://portal.edirepository.org/nis/mapbrowse?packageid=knb-lter- nes.1.2](\\"https://portal.edirepository.org/nis/mapbrowse?packageid=knb-lter- nes.1.2\\") HPLC were analyzed at Horn Point Lab, as per NASA protocol. The summary protocol for HPLC and chl is available from Seabass: [https://seabass.gsfc.nasa.gov/archive/WHOI/MVCO/documents](\\"https://seabass.gsfc.nasa.gov/archive/WHOI/MVCO/documents\\") Sequencing data: Volumes of water ranging from 0.75 to 2.5L were filtered in duplicate onto 45mm 0.22 \u00b5m Durapore GV filters under gentle vacuum. Filters were cut in half, placed into sterile 1.5 ml microfuge tubes, and stored at -80C until extraction. Nucleic acids were extracted using the Zymo Research Fungal/Bacterial DNA MicroPrep Kit (Zymo Research Products). One half filter for each sample was transferred to a 2 ml microcentrifuge tube with silica beads and lysis buffer, and then shaken using a vortex adapter for 5 minutes. The extraction was then processed following the kit instructions and the eluted DNA frozen at -20C. The eukaryotic ribosomal RNA gene V4 region was targeted for amplification and sequencing using 574V4F (5' [TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG]CGGTAAYTCCAGCTCYV) and 1132V4R (5' [GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG]CCGTCAATTHCTTYAART), described in Hugerth et al. (2014) and modified to include 5' adapter sequences for Illumina MiSeq (in square brackets). PCR reactions were accomplished in triplicate for each sample using 1 \u00b5l template DNA, 1.25 units AmpliTaq GoldR 360 DNA polymerase, 2mM MgCl2, 2 \u00b5l 2.5 \u00b5M dNTPs, and 2.5 \u00b5l 10X reaction buffer (25 \u00b5l total volume) with the conditions: 95C for 8 minutes; 40 cycles of 95C for 30 seconds, 58C for 30 seconds, 72C for 90 seconds; 72C for 5 minutes; 4C hold. No template negative controls were included with every set of PCRs. Each sample reaction was examined to confirm the correct product size of approximately 500 bp. Triplicate reactions were pooled and purified using either DNA Clean and Concentrator \u2013 5 kit (Zymo Research) or AMPure XP beads. The samples were sent to the University of Rhode Island Genomics and Sequencing Center for library preparation and Illumina MiSeq (250 bp paired end; 500 cycle kit V2) sequencing. Samples 1-27 and 28-62 were sequenced in separate runs about a year apart. Ciliate-specific amplicons were generated by amplifying the region between 152-528 bp of the 18S ribosomal RNA gene. The primers used for amplification are from Doherty et al 2007 (Aquatic Microbial Ecology). Primers were modified to carry 5' adapter sequences as noted above. AmpliTaq Gold 360 was used for amplification, and triplicate reactions were accomplished for each sample. Replicates were combined and purified using Agencourt AMPure XP. Products were sent to URI Genomics and Sequencing Center for Illumina MiSeq. V4 amplicon raw reads are available at NCBI SRA project PRJNA504617. Ciliate amplicon raw reads are available at NCBI SRA project PRJNA626352. The Imaging FlowCytobot Dashboard for shared access to image data and data products, including MVCO time series, is available at [https://ifcb- data.whoi.edu/mvco](\\"https://ifcb-data.whoi.edu/mvco\\") and the WHOI dock time series is available at [https://ifcb-data.whoi.edu/WHOI_dock](\\"https ://ifcb-data.whoi.edu/WHOI_dock\\"). |
attribute | NC_GLOBAL | awards_0_award_nid | String | 564652 |
attribute | NC_GLOBAL | awards_0_award_number | String | OCE-1434440 |
attribute | NC_GLOBAL | awards_0_data_url | String | http://www.nsf.gov/awardsearch/showAward.do?AwardNumber=1434440![]() |
attribute | NC_GLOBAL | awards_0_funder_name | String | NSF Division of Ocean Sciences |
attribute | NC_GLOBAL | awards_0_funding_acronym | String | NSF OCE |
attribute | NC_GLOBAL | awards_0_funding_source_nid | String | 355 |
attribute | NC_GLOBAL | awards_0_program_manager | String | David L. Garrison |
attribute | NC_GLOBAL | awards_0_program_manager_nid | String | 50534 |
attribute | NC_GLOBAL | cdm_data_type | String | Other |
attribute | NC_GLOBAL | comment | String | Environmental measurements from MVCO PI: Rebecca Gast (WHOI) Version date: 05 June 2020 |
attribute | NC_GLOBAL | Conventions | String | COARDS, CF-1.6, ACDD-1.3 |
attribute | NC_GLOBAL | creator_email | String | info at bco-dmo.org |
attribute | NC_GLOBAL | creator_name | String | BCO-DMO |
attribute | NC_GLOBAL | creator_type | String | institution |
attribute | NC_GLOBAL | creator_url | String | https://www.bco-dmo.org/![]() |
attribute | NC_GLOBAL | data_source | String | extract_data_as_tsv version 2.3 19 Dec 2019 |
attribute | NC_GLOBAL | dataset_current_state | String | Final and no updates |
attribute | NC_GLOBAL | date_created | String | 2020-06-05T15:46:43Z |
attribute | NC_GLOBAL | date_modified | String | 2020-06-08T19:13:44Z |
attribute | NC_GLOBAL | defaultDataQuery | String | &time<now |
attribute | NC_GLOBAL | doi | String | 10.26008/1912/bco-dmo.814424.1 |
attribute | NC_GLOBAL | infoUrl | String | https://www.bco-dmo.org/dataset/814424![]() |
attribute | NC_GLOBAL | institution | String | BCO-DMO |
attribute | NC_GLOBAL | instruments_0_acronym | String | Niskin bottle |
attribute | NC_GLOBAL | instruments_0_dataset_instrument_nid | String | 814431 |
attribute | NC_GLOBAL | instruments_0_description | String | A Niskin bottle (a next generation water sampler based on the Nansen bottle) is a cylindrical, non-metallic water collection device with stoppers at both ends. The bottles can be attached individually on a hydrowire or deployed in 12, 24, or 36 bottle Rosette systems mounted on a frame and combined with a CTD. Niskin bottles are used to collect discrete water samples for a range of measurements including pigments, nutrients, plankton, etc. |
attribute | NC_GLOBAL | instruments_0_instrument_external_identifier | String | https://vocab.nerc.ac.uk/collection/L22/current/TOOL0412/![]() |
attribute | NC_GLOBAL | instruments_0_instrument_name | String | Niskin bottle |
attribute | NC_GLOBAL | instruments_0_instrument_nid | String | 413 |
attribute | NC_GLOBAL | instruments_1_acronym | String | CTD Sea-Bird |
attribute | NC_GLOBAL | instruments_1_dataset_instrument_nid | String | 814464 |
attribute | NC_GLOBAL | instruments_1_description | String | Conductivity, Temperature, Depth (CTD) sensor package from SeaBird Electronics, no specific unit identified. This instrument designation is used when specific make and model are not known. See also other SeaBird instruments listed under CTD. More information from Sea-Bird Electronics. |
attribute | NC_GLOBAL | instruments_1_instrument_external_identifier | String | https://vocab.nerc.ac.uk/collection/L05/current/130/![]() |
attribute | NC_GLOBAL | instruments_1_instrument_name | String | CTD Sea-Bird |
attribute | NC_GLOBAL | instruments_1_instrument_nid | String | 447 |
attribute | NC_GLOBAL | instruments_1_supplied_name | String | CTD |
attribute | NC_GLOBAL | instruments_2_acronym | String | Fluorometer |
attribute | NC_GLOBAL | instruments_2_dataset_instrument_nid | String | 814465 |
attribute | NC_GLOBAL | instruments_2_description | String | A fluorometer or fluorimeter is a device used to measure parameters of fluorescence: its intensity and wavelength distribution of emission spectrum after excitation by a certain spectrum of light. The instrument is designed to measure the amount of stimulated electromagnetic radiation produced by pulses of electromagnetic radiation emitted into a water sample or in situ. |
attribute | NC_GLOBAL | instruments_2_instrument_external_identifier | String | https://vocab.nerc.ac.uk/collection/L05/current/113/![]() |
attribute | NC_GLOBAL | instruments_2_instrument_name | String | Fluorometer |
attribute | NC_GLOBAL | instruments_2_instrument_nid | String | 484 |
attribute | NC_GLOBAL | instruments_2_supplied_name | String | Turner Designs Aquafluor Handheld 800446 |
attribute | NC_GLOBAL | instruments_3_acronym | String | bucket |
attribute | NC_GLOBAL | instruments_3_dataset_instrument_nid | String | 814432 |
attribute | NC_GLOBAL | instruments_3_description | String | A bucket used to collect surface sea water samples. |
attribute | NC_GLOBAL | instruments_3_instrument_external_identifier | String | https://vocab.nerc.ac.uk/collection/L22/current/TOOL0536/![]() |
attribute | NC_GLOBAL | instruments_3_instrument_name | String | bucket |
attribute | NC_GLOBAL | instruments_3_instrument_nid | String | 569 |
attribute | NC_GLOBAL | instruments_3_supplied_name | String | bucket |
attribute | NC_GLOBAL | instruments_4_acronym | String | Thermal Cycler |
attribute | NC_GLOBAL | instruments_4_dataset_instrument_nid | String | 814433 |
attribute | NC_GLOBAL | instruments_4_description | String | General term for a laboratory apparatus commonly used for performing polymerase chain reaction (PCR). The device has a thermal block with holes where tubes with the PCR reaction mixtures can be inserted. The cycler then raises and lowers the temperature of the block in discrete, pre-programmed steps. (adapted from http://serc.carleton.edu/microbelife/research_methods/genomics/pcr.html) |
attribute | NC_GLOBAL | instruments_4_instrument_name | String | PCR Thermal Cycler |
attribute | NC_GLOBAL | instruments_4_instrument_nid | String | 471582 |
attribute | NC_GLOBAL | keywords | String | alloxanthin, ammonia, ammonium, bco, bco-dmo, biological, but, carotene, chemical, chemistry, chl, chlorophyll, concentration, concentration_of_chlorophyll_in_sea_water, data, dataset, date, diadinoxanthin, diatoxanthin, dmo, earth, Earth Science > Oceans > Ocean Chemistry > Ammonia, Earth Science > Oceans > Ocean Chemistry > Chlorophyll, Earth Science > Oceans > Ocean Chemistry > Nitrate, erddap, event, Event_Number, fucoxanthin, hex, hplc, HPLC_Alloxanthin, HPLC_But_Fucoxanthin, HPLC_Carotene, HPLC_Diadinoxanthin, HPLC_Diatoxanthin, HPLC_Fucoxanthin, HPLC_Hex_Fucoxanthin, HPLC_Peridinin, HPLC_Total_Chl_a, HPLC_Total_Chl_b, HPLC_Total_Chl_c, HPLC_Zeaxanthin, management, mole, mole_concentration_of_ammonium_in_sea_water, mole_concentration_of_nitrate_in_sea_water, n02, nh4, nitrate, NO2_NO3, no3, number, O2, ocean, oceanography, oceans, office, oxygen, peridinin, phaeo, po43, preliminary, science, sea, seawater, SiO2, start, temperature, time, total, water, zeaxanthin |
attribute | NC_GLOBAL | keywords_vocabulary | String | GCMD Science Keywords |
attribute | NC_GLOBAL | license | String | https://www.bco-dmo.org/dataset/814424/license![]() |
attribute | NC_GLOBAL | metadata_source | String | https://www.bco-dmo.org/api/dataset/814424![]() |
attribute | NC_GLOBAL | param_mapping | String | {'814424': {}} |
attribute | NC_GLOBAL | parameter_source | String | https://www.bco-dmo.org/mapserver/dataset/814424/parameters![]() |
attribute | NC_GLOBAL | people_0_affiliation | String | Woods Hole Oceanographic Institution |
attribute | NC_GLOBAL | people_0_affiliation_acronym | String | WHOI |
attribute | NC_GLOBAL | people_0_person_name | String | Rebecca J. Gast |
attribute | NC_GLOBAL | people_0_person_nid | String | 51278 |
attribute | NC_GLOBAL | people_0_role | String | Principal Investigator |
attribute | NC_GLOBAL | people_0_role_type | String | originator |
attribute | NC_GLOBAL | people_1_affiliation | String | Woods Hole Oceanographic Institution |
attribute | NC_GLOBAL | people_1_affiliation_acronym | String | WHOI |
attribute | NC_GLOBAL | people_1_person_name | String | Taylor Crockford |
attribute | NC_GLOBAL | people_1_person_nid | String | 814428 |
attribute | NC_GLOBAL | people_1_role | String | Contact |
attribute | NC_GLOBAL | people_1_role_type | String | related |
attribute | NC_GLOBAL | people_2_affiliation | String | Woods Hole Oceanographic Institution |
attribute | NC_GLOBAL | people_2_affiliation_acronym | String | WHOI BCO-DMO |
attribute | NC_GLOBAL | people_2_person_name | String | Shannon Rauch |
attribute | NC_GLOBAL | people_2_person_nid | String | 51498 |
attribute | NC_GLOBAL | people_2_role | String | BCO-DMO Data Manager |
attribute | NC_GLOBAL | people_2_role_type | String | related |
attribute | NC_GLOBAL | project | String | Staining IFCB |
attribute | NC_GLOBAL | projects_0_acronym | String | Staining IFCB |
attribute | NC_GLOBAL | projects_0_description | String | Description from NSF award abstract: Some of the most important primary producers and consumers in aquatic ecosystems are protists, or single-celled eukaryotes. It is well established that protistan predation can be a significant source of mortality for bacteria and phytoplankton. Grazing protists in turn serve as prey for zooplankton (copepods), and through the excretion of nitrogen and phosphorus compounds, they play a major role in the release of regenerated nutrients. Despite decades of studies on protistan grazing, knowledge gaps still exist with respect to their abundance, distribution, seasonality, prey selectivity, and co-occurrence patterns. The results from this project will advance the understanding of grazing communities in situ and how they respond to environmental conditions and prey communities. This will be one of very few studies of grazers that is unbiased by artificial prey and containment, and will yield both morphologic and genetic information about the organisms present and the distribution patterns of particular grazer populations. This project examines whether the persistence of a group of protistan grazers is determined by its feeding strategy (grazers with specialist feeding strategies are more ephemeral than generalists), and whether certain morphotypes exhibiting generalist feeding strategies have underlying genotypic diversity that maps to specialist feeding strategies. It builds upon an ongoing time series (with hourly resolution since 2006) of automated, high-resolution, measurements of the phytoplankton community by the Imaging FlowCytobot at the Martha's Vineyard Coastal Observatory. These measurements have led to the observation that, in addition to shifts from pico- and small nanoplankton during the summer to larger microplankton in the fall and winter, particular species (especially among the diatoms) exhibit distinct and recurring seasonal patterns. The instrument will be modified to also conduct automated measurements of grazer communities in situ. Links between selected grazer taxa (chosen based on the image time series) and phytoplankton prey will be provided through genetic analyses of individual cells (with their ingested prey). These cells will be obtained by use of a recently developed cell sorter that also captures an image of each sorted cell. In addition to providing predator/prey links, the genetic information will allow the investigators to determine whether a grazer morphotype represents multiple species. A third approach, high throughput sequencing and quantitative PCR analysis of whole water samples, will be applied to investigate abundance patterns of species whose morphology does not reliably map to genotype. |
attribute | NC_GLOBAL | projects_0_end_date | String | 2017-08 |
attribute | NC_GLOBAL | projects_0_geolocation | String | Martha’s Vineyard Coastal Observatory, WHOI Dock |
attribute | NC_GLOBAL | projects_0_name | String | Dynamics of Protistan Grazers: Diversity, Abundance and Prey Relations |
attribute | NC_GLOBAL | projects_0_project_nid | String | 564653 |
attribute | NC_GLOBAL | projects_0_start_date | String | 2014-09 |
attribute | NC_GLOBAL | publisher_name | String | Biological and Chemical Oceanographic Data Management Office (BCO-DMO) |
attribute | NC_GLOBAL | publisher_type | String | institution |
attribute | NC_GLOBAL | sourceUrl | String | (local files) |
attribute | NC_GLOBAL | standard_name_vocabulary | String | CF Standard Name Table v55 |
attribute | NC_GLOBAL | summary | String | This dataset contains environmental measurements from Martha's Vineyard Coastal Observatory (MVCO) made from 2013-2017. Related high throughput sequencing data are available from NCBI under project numbers PRJNA504617 and PRJNA626352. |
attribute | NC_GLOBAL | title | String | [MVCO environmental measurements and high throughput sequencing] - Environmental measurements and high throughput sequencing data from samples collected at Martha's Vineyard Coastal Observation (MVCO) from 2013-2017 (Dynamics of Protistan Grazers: Diversity, Abundance and Prey Relations) |
attribute | NC_GLOBAL | version | String | 1 |
attribute | NC_GLOBAL | xml_source | String | osprey2erddap.update_xml() v1.5 |
variable | Start_Date | String | ||
attribute | Start_Date | bcodmo_name | String | date |
attribute | Start_Date | description | String | Date sampled; format: yyyy-mm-dd |
attribute | Start_Date | long_name | String | Start Date |
attribute | Start_Date | nerc_identifier | String | https://vocab.nerc.ac.uk/collection/P01/current/ADATAA01/![]() |
attribute | Start_Date | source_name | String | Start_Date |
attribute | Start_Date | time_precision | String | 1970-01-01 |
attribute | Start_Date | units | String | unitless |
variable | Event_Number | String | ||
attribute | Event_Number | bcodmo_name | String | event |
attribute | Event_Number | description | String | MVCO event number |
attribute | Event_Number | long_name | String | Event Number |
attribute | Event_Number | nerc_identifier | String | https://vocab.nerc.ac.uk/collection/P01/current/EVTAGFL/![]() |
attribute | Event_Number | units | String | unitless |
variable | Temperature | double | ||
attribute | Temperature | _FillValue | double | NaN |
attribute | Temperature | actual_range | double | -0.154585729, 21.46489198 |
attribute | Temperature | bcodmo_name | String | temperature |
attribute | Temperature | description | String | water temperature |
attribute | Temperature | long_name | String | Temperature |
attribute | Temperature | nerc_identifier | String | https://vocab.nerc.ac.uk/collection/P01/current/TEMPP901/![]() |
attribute | Temperature | units | String | degress Celsius |
variable | Chl | double | ||
attribute | Chl | _FillValue | double | NaN |
attribute | Chl | actual_range | double | 0.453470189, 5.90969435 |
attribute | Chl | bcodmo_name | String | chl_tot |
attribute | Chl | description | String | total chlorophyll |
attribute | Chl | long_name | String | CHL |
attribute | Chl | units | String | micrograms per liter (ug per liter) |
variable | Phaeo | double | ||
attribute | Phaeo | _FillValue | double | NaN |
attribute | Phaeo | actual_range | double | -0.489065804, 1.642379855 |
attribute | Phaeo | bcodmo_name | String | phaeopigment |
attribute | Phaeo | description | String | total phaeo pigment |
attribute | Phaeo | long_name | String | Phaeo |
attribute | Phaeo | nerc_identifier | String | https://vocab.nerc.ac.uk/collection/P01/current/PHAEFMP1/![]() |
attribute | Phaeo | units | String | ug per liter |
variable | NO2_NO3 | double | ||
attribute | NO2_NO3 | _FillValue | double | NaN |
attribute | NO2_NO3 | actual_range | double | 0.0, 2.856747593 |
attribute | NO2_NO3 | bcodmo_name | String | NO3_NO2 |
attribute | NO2_NO3 | colorBarMaximum | double | 50.0 |
attribute | NO2_NO3 | colorBarMinimum | double | 0.0 |
attribute | NO2_NO3 | description | String | nitrate and nitrite |
attribute | NO2_NO3 | long_name | String | Mole Concentration Of Nitrate In Sea Water |
attribute | NO2_NO3 | units | String | micromolar |
variable | NH4 | double | ||
attribute | NH4 | _FillValue | double | NaN |
attribute | NH4 | actual_range | double | 0.0, 3.315585523 |
attribute | NH4 | bcodmo_name | String | Ammonium |
attribute | NH4 | colorBarMaximum | double | 5.0 |
attribute | NH4 | colorBarMinimum | double | 0.0 |
attribute | NH4 | description | String | ammonia |
attribute | NH4 | long_name | String | Mole Concentration Of Ammonium In Sea Water |
attribute | NH4 | nerc_identifier | String | https://vocab.nerc.ac.uk/collection/P01/current/AMONAAZX/![]() |
attribute | NH4 | units | String | micromolar |
variable | SiO2 | double | ||
attribute | SiO2 | _FillValue | double | NaN |
attribute | SiO2 | actual_range | double | 0.0, 15.200309295 |
attribute | SiO2 | bcodmo_name | String | Si |
attribute | SiO2 | description | String | silicate |
attribute | SiO2 | long_name | String | Si O2 |
attribute | SiO2 | units | String | micromolar |
variable | PO43 | double | ||
attribute | PO43 | _FillValue | double | NaN |
attribute | PO43 | actual_range | double | 0.0, 0.654410322 |
attribute | PO43 | bcodmo_name | String | PO4 |
attribute | PO43 | description | String | phosphate |
attribute | PO43 | long_name | String | PO43 |
attribute | PO43 | units | String | micromolar |
variable | HPLC_Total_Chl_a | float | ||
attribute | HPLC_Total_Chl_a | _FillValue | float | NaN |
attribute | HPLC_Total_Chl_a | actual_range | float | 0.378, 6.431 |
attribute | HPLC_Total_Chl_a | bcodmo_name | String | chlorophyll a |
attribute | HPLC_Total_Chl_a | colorBarMaximum | double | 30.0 |
attribute | HPLC_Total_Chl_a | colorBarMinimum | double | 0.03 |
attribute | HPLC_Total_Chl_a | colorBarScale | String | Log |
attribute | HPLC_Total_Chl_a | description | String | HPLC determined chlorophyll a |
attribute | HPLC_Total_Chl_a | long_name | String | Concentration Of Chlorophyll In Sea Water |
attribute | HPLC_Total_Chl_a | nerc_identifier | String | https://vocab.nerc.ac.uk/collection/P01/current/CPHLHPP1/![]() |
attribute | HPLC_Total_Chl_a | units | String | ug per liter |
variable | HPLC_Total_Chl_b | float | ||
attribute | HPLC_Total_Chl_b | _FillValue | float | NaN |
attribute | HPLC_Total_Chl_b | actual_range | float | 0.021, 0.568 |
attribute | HPLC_Total_Chl_b | bcodmo_name | String | chl_b |
attribute | HPLC_Total_Chl_b | description | String | HPLC determined chlorophyll b |
attribute | HPLC_Total_Chl_b | long_name | String | HPLC Total Chl B |
attribute | HPLC_Total_Chl_b | nerc_identifier | String | https://vocab.nerc.ac.uk/collection/P01/current/CHLBHPP1/![]() |
attribute | HPLC_Total_Chl_b | units | String | ug per liter |
variable | HPLC_Total_Chl_c | float | ||
attribute | HPLC_Total_Chl_c | _FillValue | float | NaN |
attribute | HPLC_Total_Chl_c | actual_range | float | 0.091, 1.433 |
attribute | HPLC_Total_Chl_c | bcodmo_name | String | chl_c |
attribute | HPLC_Total_Chl_c | description | String | HPLC determined chlorophyll c |
attribute | HPLC_Total_Chl_c | long_name | String | HPLC Total Chl C |
attribute | HPLC_Total_Chl_c | units | String | ug per liter |
variable | HPLC_Carotene | float | ||
attribute | HPLC_Carotene | _FillValue | float | NaN |
attribute | HPLC_Carotene | actual_range | float | 0.024, 0.231 |
attribute | HPLC_Carotene | bcodmo_name | String | carotene |
attribute | HPLC_Carotene | description | String | HPLC determined carotene |
attribute | HPLC_Carotene | long_name | String | HPLC Carotene |
attribute | HPLC_Carotene | nerc_identifier | String | https://vocab.nerc.ac.uk/collection/P01/current/ABCRHPP1/![]() |
attribute | HPLC_Carotene | units | String | ug per liter |
variable | HPLC_But_Fucoxanthin | float | ||
attribute | HPLC_But_Fucoxanthin | _FillValue | float | NaN |
attribute | HPLC_But_Fucoxanthin | actual_range | float | 0.0, 0.258 |
attribute | HPLC_But_Fucoxanthin | bcodmo_name | String | fucox_but |
attribute | HPLC_But_Fucoxanthin | description | String | HPLC determined 19'-butanolyloxyfucoxanthin |
attribute | HPLC_But_Fucoxanthin | long_name | String | HPLC But Fucoxanthin |
attribute | HPLC_But_Fucoxanthin | units | String | ug per liter |
variable | HPLC_Hex_Fucoxanthin | float | ||
attribute | HPLC_Hex_Fucoxanthin | _FillValue | float | NaN |
attribute | HPLC_Hex_Fucoxanthin | actual_range | float | 0.0, 0.32 |
attribute | HPLC_Hex_Fucoxanthin | bcodmo_name | String | fucox_hex |
attribute | HPLC_Hex_Fucoxanthin | description | String | HPLC determined 19'-hexanoyloxyfucoxanthin |
attribute | HPLC_Hex_Fucoxanthin | long_name | String | HPLC Hex Fucoxanthin |
attribute | HPLC_Hex_Fucoxanthin | units | String | ug per liter |
variable | HPLC_Alloxanthin | float | ||
attribute | HPLC_Alloxanthin | _FillValue | float | NaN |
attribute | HPLC_Alloxanthin | actual_range | float | 0.005, 0.3215 |
attribute | HPLC_Alloxanthin | bcodmo_name | String | allox |
attribute | HPLC_Alloxanthin | description | String | HPLC determined alloxanthin |
attribute | HPLC_Alloxanthin | long_name | String | HPLC Alloxanthin |
attribute | HPLC_Alloxanthin | nerc_identifier | String | https://vocab.nerc.ac.uk/collection/P01/current/ALLOHPP1/![]() |
attribute | HPLC_Alloxanthin | units | String | ug per liter |
variable | HPLC_Diadinoxanthin | float | ||
attribute | HPLC_Diadinoxanthin | _FillValue | float | NaN |
attribute | HPLC_Diadinoxanthin | actual_range | float | 0.056, 0.541 |
attribute | HPLC_Diadinoxanthin | bcodmo_name | String | diadinox |
attribute | HPLC_Diadinoxanthin | description | String | HPLC determined Diadinoxanthin |
attribute | HPLC_Diadinoxanthin | long_name | String | HPLC Diadinoxanthin |
attribute | HPLC_Diadinoxanthin | nerc_identifier | String | https://vocab.nerc.ac.uk/collection/P01/current/DIADHPP1/![]() |
attribute | HPLC_Diadinoxanthin | units | String | ug per liter |
variable | HPLC_Diatoxanthin | float | ||
attribute | HPLC_Diatoxanthin | _FillValue | float | NaN |
attribute | HPLC_Diatoxanthin | actual_range | float | 0.0045, 0.07 |
attribute | HPLC_Diatoxanthin | bcodmo_name | String | diatox |
attribute | HPLC_Diatoxanthin | description | String | HPLC determined Diatoxanthin |
attribute | HPLC_Diatoxanthin | long_name | String | HPLC Diatoxanthin |
attribute | HPLC_Diatoxanthin | nerc_identifier | String | https://vocab.nerc.ac.uk/collection/P01/current/DIATHPP1/![]() |
attribute | HPLC_Diatoxanthin | units | String | ug per liter |
variable | HPLC_Fucoxanthin | float | ||
attribute | HPLC_Fucoxanthin | _FillValue | float | NaN |
attribute | HPLC_Fucoxanthin | actual_range | float | 0.081, 2.912 |
attribute | HPLC_Fucoxanthin | bcodmo_name | String | fucox |
attribute | HPLC_Fucoxanthin | description | String | HPLC determined Fucoxanthin |
attribute | HPLC_Fucoxanthin | long_name | String | HPLC Fucoxanthin |
attribute | HPLC_Fucoxanthin | nerc_identifier | String | https://vocab.nerc.ac.uk/collection/P01/current/FUCXHPP1/![]() |
attribute | HPLC_Fucoxanthin | units | String | ug per liter |
variable | HPLC_Peridinin | float | ||
attribute | HPLC_Peridinin | _FillValue | float | NaN |
attribute | HPLC_Peridinin | actual_range | float | 0.0, 0.482 |
attribute | HPLC_Peridinin | bcodmo_name | String | peridinin |
attribute | HPLC_Peridinin | description | String | HPLC determined Peridinin |
attribute | HPLC_Peridinin | long_name | String | HPLC Peridinin |
attribute | HPLC_Peridinin | nerc_identifier | String | https://vocab.nerc.ac.uk/collection/P01/current/PERIHPP1/![]() |
attribute | HPLC_Peridinin | units | String | ug per liter |
variable | HPLC_Zeaxanthin | float | ||
attribute | HPLC_Zeaxanthin | _FillValue | float | NaN |
attribute | HPLC_Zeaxanthin | actual_range | float | 0.0, 0.113 |
attribute | HPLC_Zeaxanthin | bcodmo_name | String | zeax |
attribute | HPLC_Zeaxanthin | description | String | HPLC determined Zeaxanthin |
attribute | HPLC_Zeaxanthin | long_name | String | HPLC Zeaxanthin |
attribute | HPLC_Zeaxanthin | nerc_identifier | String | https://vocab.nerc.ac.uk/collection/P01/current/ZEOXHPP1/![]() |
attribute | HPLC_Zeaxanthin | units | String | ug per liter |
The information in the table above is also available in other file formats (.csv, .htmlTable, .itx, .json, .jsonlCSV1, .jsonlCSV, .jsonlKVP, .mat, .nc, .nccsv, .tsv, .xhtml) via a RESTful web service.